SRMA - Error - cs TAG

mrxcm3 · 06-17-2011, 03:32 AM

Hi,

First time using SRMA, followed the user guide on source forge. Left all variables as defaults. It came up with this error. Any suggestions as to what I need to do to fix this?

chris@deepseq:~/DeepSeq/SRMA$ java -jar srma-0.1.15.jar I=1.3_case_sort2_head.bam O=srma_1.3_case.bam R=valid_4.fa CORRECT_BASES=FALSE
[Fri Jun 17 11:17:23 BST 2011] srma.SRMA INPUT=[1.3_case_sort2_head.bam] OUTPUT=[srma_1.3_case.bam] REFERENCE=valid_4.fa CORRECT_BASES=false OFFSET=20 MIN_MAPQ=0 MINIMUM_ALLELE_PROBABILITY=0.1 MINIMUM_ALLELE_COVERAGE=3 MAXIMUM_TOTAL_COVERAGE=100 USE_SEQUENCE_QUALITIES=true QUIET_STDERR=false MAX_HEAP_SIZE=8192 MAX_QUEUE_SIZE=65536 GRAPH_PRUNING=false NUM_THREADS=1 TMP_DIR=/tmp/chris VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
Allele coverage cutoffs:
coverage: 1 minimum allele coverage: 0
coverage: 2 minimum allele coverage: 0
coverage: 3 minimum allele coverage: 0
coverage: 4 minimum allele coverage: 1
coverage: 5 minimum allele coverage: 1
coverage: 6 minimum allele coverage: 1
coverage: 7 minimum allele coverage: 2
coverage: 8 minimum allele coverage: 2
coverage: 9 minimum allele coverage: 3
coverage: >9 minimum allele coverage: 3
java.lang.Exception: Error. The current alignment's read bases length does not match the length of the colors in the CS tag.
at srma.Align.align(Align.java:115)
at srma.SRMA$AlignThread.run(SRMA.java:659

nilshomer · 06-17-2011, 10:22 AM

It looks like your SAM file is malformed. Can you make sure that the following assertion is true as indicated by the error message: "The current alignment's read bases length does not match the length of the colors in the CS tag."? You can also print a few SAM records here so we can take a look.

mrxcm3 · 06-20-2011, 04:41 AM

Hi,

Thanks for the reply - I figured this may the case. Here is the SAM. Thanks for taking a look.

@HD VN:1.0 GO:none SO:coordinate
@SQ SN:4 LN:191154276 UR:file:/data/results/Morgan/human_amplicon_F3_genome_bioscope1.3/genome/Homo_sapiens.GRCh37.59.dna.toplevel.chr_only.valid.fa
@RG ID:20101201200842917 PL:SOLiD LB:lib1-50F PI:0 DT:2010-12-01T12:08:42-0800 SM:case CN:freetext
@PG ID:MaToBam VN:1.12
100_905_888 0 4 88451319 100 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIII:III7@IIIEFIH@38G426CIII5BIIB;:2 RG:Z:20101201200842917 NH:i:1 CM:i:1 CQ:Z:ABBABAA@9ABBA?@@@<.-=@3%<;>9-:;.3D80%.);7>.(;<03)2 CS:Z:T03322021101120202301233121003002130210333330102222
101_846_1575 0 4 88451319 86 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACGGGTTATATAACCTCTC IIIIIIIIIIIIIIIIII9;II<@III?DII9)66%;IIIII=IIG52*% RG:Z:20101201200842917 NH:i:1 CM:i:3 CQ:Z:BB?BBA<B2AA9=>A7@75%7A<D@;>-32<1)D6D%75<;<.0;?)-&% CS:Z:T03322021101120202301233021003002130010333330102222
102_1531_973 0 4 88451319 100 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIIE@III;5IIIGEIII<2;3=@FIII3CIII@E: RG:Z:20101201200842917 NH:i:1 CM:i:1 CQ:Z:>BB@B??@A>ABA@A;@42/?@;D5?><,:7=8%..&8)>9>-'=:95,: CS:Z:T03322021101120202301233221003002110210333330102222
102_681_1033 0 4 88451319 97 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIIIBIII=9IIIBGIII%%>3&&4FIA7IIII@7- RG:Z:20101201200842917 NH:i:1 CM:i:2 CQ:Z:BBBBBA@@<A@AA<?7@86->=5)1=;7,<?=2%1.&'&/89)/=976+- CS:Z:T03322021101120202301233121003002100211333330102222

nilshomer · 06-20-2011, 10:12 AM

Those lines look fine, so it may be a problem later in the file. I have just committed code to the git repository to output the read name for that specific error. Can you install the version from the git repository and then identify the specific read?

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Bfast color space tag and GATK error	adamhfreedman	Bioinformatics	5	08-21-2012 08:28 AM
SRMA error	Ori	Bioinformatics	6	08-19-2011 08:09 AM
another question about SRMA	rlh	Bioinformatics	2	10-23-2010 11:51 PM
SRMA Error	dmurdock	Bioinformatics	14	10-21-2010 06:02 PM
srma-0.1.8 error - Cannot check readability of null file.	allenday	Bioinformatics	1	10-12-2010 12:30 AM

06-17-2011, 03:32 AM	#1
mrxcm3 Junior Member Location: Nottingham Join Date: Oct 2010 Posts: 9	SRMA - Error - cs TAG Hi, First time using SRMA, followed the user guide on source forge. Left all variables as defaults. It came up with this error. Any suggestions as to what I need to do to fix this? chris@deepseq:~/DeepSeq/SRMA$ java -jar srma-0.1.15.jar I=1.3_case_sort2_head.bam O=srma_1.3_case.bam R=valid_4.fa CORRECT_BASES=FALSE [Fri Jun 17 11:17:23 BST 2011] srma.SRMA INPUT=[1.3_case_sort2_head.bam] OUTPUT=[srma_1.3_case.bam] REFERENCE=valid_4.fa CORRECT_BASES=false OFFSET=20 MIN_MAPQ=0 MINIMUM_ALLELE_PROBABILITY=0.1 MINIMUM_ALLELE_COVERAGE=3 MAXIMUM_TOTAL_COVERAGE=100 USE_SEQUENCE_QUALITIES=true QUIET_STDERR=false MAX_HEAP_SIZE=8192 MAX_QUEUE_SIZE=65536 GRAPH_PRUNING=false NUM_THREADS=1 TMP_DIR=/tmp/chris VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false Allele coverage cutoffs: coverage: 1 minimum allele coverage: 0 coverage: 2 minimum allele coverage: 0 coverage: 3 minimum allele coverage: 0 coverage: 4 minimum allele coverage: 1 coverage: 5 minimum allele coverage: 1 coverage: 6 minimum allele coverage: 1 coverage: 7 minimum allele coverage: 2 coverage: 8 minimum allele coverage: 2 coverage: 9 minimum allele coverage: 3 coverage: >9 minimum allele coverage: 3 java.lang.Exception: Error. The current alignment's read bases length does not match the length of the colors in the CS tag. at srma.Align.align(Align.java:115) at srma.SRMA$AlignThread.run(SRMA.java:659

06-20-2011, 04:41 AM	#3
mrxcm3 Junior Member Location: Nottingham Join Date: Oct 2010 Posts: 9	Srma Hi, Thanks for the reply - I figured this may the case. Here is the SAM. Thanks for taking a look. @HD VN:1.0 GO:none SO:coordinate @SQ SN:4 LN:191154276 UR:file:/data/results/Morgan/human_amplicon_F3_genome_bioscope1.3/genome/Homo_sapiens.GRCh37.59.dna.toplevel.chr_only.valid.fa @RG ID:20101201200842917 PL:SOLiD LB:lib1-50F PI:0 DT:2010-12-01T12:08:42-0800 SM:case CN:freetext @PG ID:MaToBam VN:1.12 100_905_888 0 4 88451319 100 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIII:III7@IIIEFIH@38G426CIII5BIIB;:2 RG:Z:20101201200842917 NH:i:1 CM:i:1 CQ:Z:ABBABAA@9ABBA?@@@<.-=@3%<;>9-:;.3D80%.);7>.(;<03)2 CS:Z:T03322021101120202301233121003002130210333330102222 101_846_1575 0 4 88451319 86 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACGGGTTATATAACCTCTC IIIIIIIIIIIIIIIIII9;II<@III?DII9)66%;IIIII=IIG52% RG:Z:20101201200842917 NH:i:1 CM:i:3 CQ:Z:BB?BBA<B2AA9=>A7@75%7A<D@;>-32<1)D6D%75<;<.0;?)-&% CS:Z:T03322021101120202301233021003002130010333330102222 102_1531_973 0 4 88451319 100 50M 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIIE@III;5IIIGEIII<2;3=@FIII3CIII@E: RG:Z:20101201200842917 NH:i:1 CM:i:1 CQ:Z:>BB@B??@A>ABA@A;@42/?@;D5?><,:7=8%..&8)>9>-'=:95,: CS:Z:T03322021101120202301233221003002110210333330102222 102_681_1033 0 4 88451319 97 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIIIBIII=9IIIBGIII%%>3&&4FIA7IIII@7- RG:Z:20101201200842917 NH:i:1 CM:i:2 CQ:Z:BBBBBA@@<A@AA<?7@86->=5)1=;7,<?=2%1.&'&/89)/=976+- CS:Z:T03322021101120202301233121003002100211333330102222

06-17-2011, 10:22 AM	#2
nilshomer Nils Homer Location: Boston, MA, USA Join Date: Nov 2008 Posts: 1,285	It looks like your SAM file is malformed. Can you make sure that the following assertion is true as indicated by the error message: "The current alignment's read bases length does not match the length of the colors in the CS tag."? You can also print a few SAM records here so we can take a look.

06-20-2011, 10:12 AM	#4
nilshomer Nils Homer Location: Boston, MA, USA Join Date: Nov 2008 Posts: 1,285	Those lines look fine, so it may be a problem later in the file. I have just committed code to the git repository to output the read name for that specific error. Can you install the version from the git repository and then identify the specific read?