SEQanswers

Go Back   SEQanswers > Introductions



Similar Threads
Thread Thread Starter Forum Replies Last Post
Error with GTF file when using htseq-count MDonlin Bioinformatics 13 01-13-2015 08:29 AM
Strange error when using htseq-count shhuang Bioinformatics 13 11-19-2012 12:40 AM
multiBamCov or htseq-count to count read per feature ? NicoBxl Bioinformatics 1 07-03-2012 02:05 AM
htseq-count error sissi Bioinformatics 0 03-20-2012 11:40 PM
htseq-count INPUT to big. Palgrave Bioinformatics 3 03-08-2012 04:45 AM

Reply
 
Thread Tools
Old 12-05-2012, 06:42 AM   #1
moser
Junior Member
 
Location: switzerland

Join Date: Oct 2011
Posts: 6
Default htseq-count error with tophat input

Hi all
When using htseq-count with sam-files from tophat and gff files from cufflinks, i got following error:

Error occured in line 1 of file /home/ubelix/sm/mm08c348/counts/ilc31se.sorted.sam.
Error: Strand must be'+', '-', or '.'.
[Exception type: ValueError, raised in _HTSeq.pyx:72]

cmd: htseq-count -t transcript -i ID -s no file.sam cufflinks.gff' > htseq-count

I checked for the strands in gff file, they look ok (either . - or +). sam file was sorted using sort -n on the bam precursor, so should be ok.
Any help on this issue would be appreciated!!
Thank you!
Michel
moser is offline   Reply With Quote
Old 05-18-2013, 05:02 AM   #2
Chinvt
Junior Member
 
Location: Blacksburg

Join Date: Apr 2012
Posts: 2
Default

I'm currently having exactly same error for name-sorted SAM version of tophat generated BAM file.

How did you solve this problem then?
Chinvt is offline   Reply With Quote
Old 10-20-2013, 05:50 PM   #3
alanlhutchison
Junior Member
 
Location: Chicago

Join Date: Sep 2013
Posts: 1
Default

Hello,

I am having the same problem. Here is the error and the first line of the file in question (paths redacted):

Error occured in line 1 of file HC25_4-1_ZT02_1_combined_2.sam.
Error: Strand must be'+', '-', or '.'.
[Exception type: ValueError, raised in _HTSeq.pyx:71]

head -1 HC25_4-1_ZT02_1_combined_2.sam

HWI-ST1083:106:C1G1MACXX:2:1113:20418:56674:1:N:0:GTGAAA 272 chr2L 49M * 0 0 GACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCAT hhiihhfgcggfiiihiifhhiiiihihhiiiiiiigggggeeeeebb_ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:49 YT:Z:UU NH:i:20 CC:Z:= CP:i:4124 HI:i:0


Any advice on the matter would be appreciated.
alanlhutchison is offline   Reply With Quote
Old 10-21-2013, 12:23 AM   #4
Simon Anders
Senior Member
 
Location: Heidelberg, Germany

Join Date: Feb 2010
Posts: 994
Default

GFF files contain strand information as '+' and '-', SAM files don't. Maybe you have passed the two file names in the wrong order.
Simon Anders is offline   Reply With Quote
Old 10-21-2013, 12:35 AM   #5
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

Quote:
Originally Posted by alanlhutchison View Post
Hello,

I am having the same problem. Here is the error and the first line of the file in question (paths redacted):

Error occured in line 1 of file HC25_4-1_ZT02_1_combined_2.sam.
Error: Strand must be'+', '-', or '.'.
[Exception type: ValueError, raised in _HTSeq.pyx:71]

head -1 HC25_4-1_ZT02_1_combined_2.sam

HWI-ST1083:106:C1G1MACXX:2:1113:20418:56674:1:N:0:GTGAAA 272 chr2L 49M * 0 0 GACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCAT hhiihhfgcggfiiihiifhhiiiihihhiiiiiiigggggeeeeebb_ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:49 YT:Z:UU NH:i:20 CC:Z:= CP:i:4124 HI:i:0


Any advice on the matter would be appreciated.
I suspect that you're putting the SAM file were the annotation file should go. The SAM file goes before the annotation file in the command.
dpryan is offline   Reply With Quote
Reply

Tags
cufflinks, deseq, htseq, htseq-count, tophat

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:32 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO