SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
strand-specific cDNA papori General 26 08-02-2017 10:30 AM
Confused about the strand FLAG of Bismark paired-end seq results Jerry_Zhao Bioinformatics 2 09-14-2012 10:45 AM
Strand-specific library appears not strand-specific oligo Illumina/Solexa 7 12-08-2011 09:54 AM
strand specific RNAseq Pepe Sample Prep / Library Generation 5 10-27-2011 07:58 AM
cuffdiff not strand-specific? burkard Bioinformatics 0 11-15-2010 10:30 AM

Reply
 
Thread Tools
Old 01-05-2013, 05:57 AM   #1
Amelie
Junior Member
 
Location: Oxford

Join Date: Dec 2012
Posts: 5
Default Tophat2 in strand-specific mode: discrepancy between 0x10 bit and XS flag

Hi,

I've got single end RNA-seq reads coming from a strand-specific protocol. After running tophat2 v2.0.6 using the --library-type fr-firststrand option, how is it possible that I get reads with bit 0x10 not set and tag XS:A:- and reads with that bit set and the same tag XS:A:- ? I thought the value of the bit would specify the value of the flag, when tophat was run in strand-specific mode.

Any idea will be much appreciated.

Amelie

WTCHG_38037_194:6:1306:15231:88771#ATGAGATC 0 10 811101 50 96M2025N4M * 0 0 CTGCAGTTGGTCTTTAATGGCTTTTGTATGAGCCAGGTCATCCTCCAAGGCCGAGATCTGCCGGTAACCCTCTGAATGCTGCATTTCAAACTTCTCCTTC BCCFFFFFHHFHDIJJJIJIIJJJJJHIJJIJJJJIJGHIJJJJJJJJIIIJHIJIIIIJJJJHEBEECCEDECDDDDDC AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:100 YT:Z:UU XS:A:- NH:i:1

WTCHG_38037_194:6:2308:7073:6272#ATGAGATC 16 10 811152 50 45M2025N55M * 0 0 CGAGATCTTCCGGTAACCCTCTGAATGCTGCATTTCAAACTTCTCCTTCACAGACTCCAGCTCCATTCGAAGGCGGTTATTCTCTGATAATAGGTCCCGG ##########@>@5556B@;5@>A>CA:>3B@DB:@?=.)? (C;9=8/8)4FC8BF=/?)2B>EF>DD<6GA@DCEBEF@?<:E4BGDDFCCABD?;@ AS:i:0 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8G91 YT:Z:UU XS:A:- NH:i:1
Amelie is offline   Reply With Quote
Reply

Tags
strand-specific, tophat, xs flag

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:21 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO