SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Different read lengths in same paired end run WinterIsComing Illumina/Solexa 1 01-08-2019 01:23 AM
Understanding Read Groups for single end and paired end data imsharmanitin Bioinformatics 1 07-10-2018 04:05 AM
Paired end reads with different lengths copacetik RNA Sequencing 9 08-04-2015 07:40 AM
Confusion about single end vs paired end read output on Illumina HiSeq acidcoated Illumina/Solexa 1 03-19-2015 09:56 AM
Velvet 1.2.10 with FASTQs of different read-lengths AND paired- and single-end? Genomics101 Bioinformatics 2 12-31-2013 07:50 AM

Reply
 
Thread Tools
Old 08-21-2020, 06:59 AM   #1
statsteam
Member
 
Location: Californica

Join Date: Sep 2009
Posts: 19
Default Paired end seq read lengths are different

Hi all,

I recently acquired a dataset from GEO (HiSeq 2500, accession: GSE107029). It is a paired-end but the read_1 is 94 bp while read_2 is 100 bp. Since I've never seen paired-end data with different read length for read_1 and read_2 from HiSeq 2500, I am wondering if anyone can help me understand why read_1 and read_2 have different read lengths.

Here are a few reads from read_1 and read_2. I downloaded data using
fastq-dump --split-files SRR6300667

Read_1 (SRR6300667_1.fastq)
@SRR6300667.1 DHCDZDN1:3:1101:1145:1177 length=94
CGGAATGCAGCAATCAATGTCGTCGGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCCGCTTGGCAGGACCATTTTTC
+SRR6300667.1 DHCDZDN1:3:1101:1145:1177 length=94
DFDHHH<EEFGGIHIIHCGFDGDF@GHFADFHGICFAEHGHECCAG@GG;EH>CCEA73?;B>@CCCCCCCCCCBBBB???C?BB@@?CCEEC#
@SRR6300667.2 DHCDZDN1:3:1101:1178:1247 length=94
GGCTCCCCCCTGCAAATGAGCCCCAGCCTTCTCCATGGTGGTGAAGACGCCAGTGGACTCCACGACGTACTCAGCGCCAGCATCGCCCCACTTG
+SRR6300667.2 DHCDZDN1:3:1101:1178:1247 length=94
FHHHHHJJJJJJJIIJJJJJIJJJJJIJJJJJJIJJJJGHHAEHIHIIHHFFCEEEEDDDDDDDDDDDABDDDDDDDDBDDDDDBDDDDDDDD@
@SRR6300667.3 DHCDZDN1:3:1101:1313:1046 length=94
TCCTTTAGCTGACCACTTCTTCAAGTAGGCCGGGGATACAAAATCCTTTTGCATGAGGAAAGCTGAAATTCCACACAGGTACCACAAGATATTA
+SRR6300667.3 DHCDZDN1:3:1101:1313:1046 length=94
EHHHHHEGBGGCHIJGHIFHIHIIIIIIJJJHIIJAHGFGIIJJCFGGGIIBCHHEHGFDEFFEEECCCEDCCCCBDDD:@CCACBBDCDDEED


Read_2 (SRR6300667_2.fastq)
@SRR6300667.1 DHCDZDN1:3:1101:1145:1177 length=100
CGATGACCAGAAAAATGGTCCTGCCAAGCGGCTACAGTGTTCTTCTTTCAGATACAGTAGGATTTATTCAGGATCTTCCGACGACATTGATTGCTGCATT
+SRR6300667.1 DHCDZDN1:3:1101:1145:1177 length=100
@<ADDDDHBHFFEGGGE<CFGHIIIIGCEGDHIGI@GGGCFGHIIIIIHCHAGGHIG@@D>DGHGCACAEEHDFFFFFEDA>B@;,5@3>ADC:A@CCC:
@SRR6300667.2 DHCDZDN1:3:1101:1178:1247 length=100
ATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGG
+SRR6300667.2 DHCDZDN1:3:1101:1178:1247 length=100
CCFFFFDHHHDADEHGGGJJJEECHGDFHGIIJCDGHIGIJJFGAHEHGGGHGBHGEHIIIGHFHEHDDDD@EACECEECDDCC>CACD<>CDCCDCCD9
@SRR6300667.3 DHCDZDN1:3:1101:1313:1046 length=100
AGCCATACAGGAGATGGGAAACCACGCTATGATACTTTCTGGAAACATTTTATATTTGTTATGATGGACATTTTGCTCGATTGGAGCATGCATAATATCT
+SRR6300667.3 DHCDZDN1:3:1101:1313:1046 length=100
BCFFFFFHHHHHIHIIIJGJFGHIJJIJJJJIIGGHIJIJJJFJIAHHIHHIJIIJJJJJGIJJIJJJIGIHHHHEHFFFEECECDA?CCDDDDCDDEEF

I am quite confused.

Thank you,
Statsteam
statsteam is offline   Reply With Quote
Old 08-21-2020, 08:38 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,079
Default

It is possible that the sequencer may have had trouble with last 6 cycles on read 1 so that part of the data has been trimmed. That can be one explanation. You should be able to use this data without any issues.
GenoMax is offline   Reply With Quote
Old 08-21-2020, 08:51 PM   #3
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,238
Default

There is no technical constraint on the length of Illumina paired-end reads apart from R1 which should be 25 cycles. In some applications using asymmetric read length is more cost effective. For instance, 10x Genomics single cell RNA-seq libraries can be sequenced in 2x100 configuration using 200 cycle sequencing kit but it can be sequenced 28 cycles for R1 and 90 cycles for R2 using 100 cycle kit with identical outcome.
nucacidhunter is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:52 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO