SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
how to get reads with "mate mapped to a different chr" gene_x Bioinformatics 12 07-18-2018 04:43 AM
MiSeq gDNA reads still fail "Kmer content" and "per base seq content" after trimming" ysnapus Illumina/Solexa 4 11-12-2014 07:25 AM
AVA-difference betweeen "computation" reads and "global align" reads CCBIO 454 Pyrosequencing 0 01-17-2014 03:13 AM
samtools flagstat reports an odd number of reads "with itself and mate mapped" syfo Bioinformatics 0 04-24-2013 03:43 AM
Creating "Consensus" Sequence between Reference and Mapped Reads roliwilhelm Genomic Resequencing 2 07-23-2012 11:21 AM

Reply
 
Thread Tools
Old 11-17-2015, 09:59 PM   #1
610617109
Member
 
Location: Beijing

Join Date: Nov 2015
Posts: 10
Default All the CIGAR strings of reads mapped by Bowtie are "I"

Hi, guys,

I'm sorry, I make a mistake, there is no problem, but I don't know how to delete the problem.

-------------------------------------------------------------------------------------------------------

I faced a problem when mapping again...
I used Bowtie to align CLIP-seq reads to genome with the parameter "-v 1" which allow the reads have one mismatch. But in the result, Bowtie treat all the nucleotides of reads as insertion. For example:

2-42 16 chr11 86397621 255 23M * 0 0 GTCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0

Does any one have any idea what happened? What should I do to make it work?

Thanks,

Yue

Last edited by 610617109; 11-17-2015 at 10:43 PM.
610617109 is offline   Reply With Quote
Old 11-18-2015, 12:42 AM   #2
yueluo
Member
 
Location: Guangzhou China

Join Date: Aug 2013
Posts: 82
Default

The 'I's you're seeing are quality scores of your read, not the CIGAR string ...
'I' in phred-33 qual is 40. Where did you get the read file and how did you perform your alignment ? I think some aligners have to option to ignore quality scores(e.g. treat all quality scores as 40).
yueluo is offline   Reply With Quote
Reply

Tags
bowtie

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:57 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO