SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
illumina small RNA sample prep v1.5 won337 Illumina/Solexa 7 03-31-2015 07:02 AM
The T4 RNA Ligase in Small RNA Illumina Kit mnkyboy RNA Sequencing 2 05-27-2014 11:57 PM
multiplexing small RNA for sequencing using Illumina Flatform miRNAtool Illumina/Solexa 0 06-28-2011 08:34 AM
Does small RNA sequencing generate comparable reads as regular Solexa sequencing? Goodluck Illumina/Solexa 1 08-19-2009 01:12 AM

Reply
 
Thread Tools
Old 07-28-2009, 02:37 PM   #1
Bruce E
Member
 
Location: Rochester,MN

Join Date: Jan 2008
Posts: 15
Default Small RNA sequencing on Illumina

2 questions. What are people using to isolate total RNA for the small RNA prep and has anyone found a way to multiplex small RNA samples?
Bruce E is offline   Reply With Quote
Old 09-16-2009, 12:37 PM   #2
haheller
Junior Member
 
Location: WI

Join Date: Sep 2009
Posts: 2
Default

Hello,
We will prepare miRNA-Seq library and send it out for sequencing on a GAII. Can anyone confirm that these adapter/Primer sequences first reported by ECO have (can) been used successfully on the GAII (and presumably GAIIx)?

Small RNA oligonucleotide sequences
RT Primer
5' CAAGCAGAAGACGGCATACGA

5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Small RNA PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Small RNA PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Small RNA Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Was (is) there a GAI instrument? Does it require different Adapter/Primer sequences? Can't find any evidence of a GAI version on Illumina website.
Thanks in advance
haheller is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:50 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO