SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
picard error: Mismatch between read length and quals length writing read shawpa Bioinformatics 0 08-20-2012 05:52 AM
beginning of quality values record not found & qual length () differs from seq length papori Bioinformatics 1 07-09-2012 12:25 PM
tophat, --mate-inner-dist and variable length reads dawe Bioinformatics 2 01-20-2012 04:47 AM
Variable length paired-end read processing using Cufflinks ZhengXia Bioinformatics 0 10-03-2011 08:23 AM
Software for variable-length PE reads shazzle Bioinformatics 1 11-15-2010 09:51 PM

Reply
 
Thread Tools
Old 11-12-2012, 12:27 PM   #1
sowalsky
Junior Member
 
Location: Boston

Join Date: Oct 2012
Posts: 4
Default Remove variable-length adaptor from beginning of read

Hi everyone,

I constructed libraries with the NuGEN WGA kit, followed by their double-stranding kit, and then into Agilent SureSelect.

I have found that a variable percentage of my unmapped reads (both R1 and R2 from Illumina 100x100 PE) contain some of the NuGEN adaptor at the beginning of the read. NuGEN ligates on their own adaptor for whole genome amplification and it is trimmed during the double-stranding step of library prep. However, incomplete trimming could mean that when I ligated on Agilent SureSelect primers, they were ligated onto a chimeric fragment containing both human gDNA and 1-20 bases of remaining NuGEN adaptor.
If the NuGEN adaptor sequence is known (FastQC flags it as an overrepresented sequence) is there a tool that will trim it from the beginning of the read down to 5 bases or so? For example, if I know the sequence is ACTGACTGACTGACTGACTG, would it trim:

ACTGACTGACTGACTGACTGNNNNNN
CTGACTGACTGACTGACTGNNNNN
TGACTGACTGACTGACTGNNNNN
GACTGACTGACTGACTGNNNNN
ACTGACTGACTGACTGNNNNN

etc, down to five bases of adaptor (or whatever # I specify) because at that length I would not know whether I'm trimming off specific sequence or adaptor. I do not want to trim of N bases from the beginning arbitrarily since most of my reads (50-90%) do not contain adaptor.

Last edited by sowalsky; 11-12-2012 at 12:55 PM.
sowalsky is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:30 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO