SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
TopHat Error: Could not find Bowtie index files /bowtie-0.12.5/indexes/. rebrendi Bioinformatics 11 06-22-2016 09:55 AM
bowtie index problem (bowtie-build and then bowtie-inspect) tgenahmet Bioinformatics 4 09-10-2013 11:51 AM
A question about BWA index louis7781x Bioinformatics 9 04-02-2012 02:23 AM
Bowtie Index Question Wei-HD Bioinformatics 5 07-29-2010 08:15 AM
Bowtie database index question polsum Bioinformatics 1 05-18-2010 10:29 AM

Reply
 
Thread Tools
Old 02-09-2010, 03:14 AM   #1
martinobarenco
Junior Member
 
Location: London

Join Date: Jan 2010
Posts: 8
Default bowtie index location question

Dear all,

when I type the command:

~/where/my/data/is $ bowtie -a -v 2 hg19 -c GTTCGATGAAATCTTCTTTTTCTGTTTTCACTTGGG

the following message is returned:

Could not locate a Bowtie index corresponding to basename "hg19"
Command: bowtie -a -v 2 -c hg19 GTTCGATGAAATCTTCTTTTTCTGTTTTCACTTGGG

whereas it works fine when run from the directory where bowtie actually is. I am a bit loth copying the data where the program is, so is there a way to specify the bowtie index(es) path?

Many thanks,

Martino
martinobarenco is offline   Reply With Quote
Old 02-09-2010, 03:33 AM   #2
manoj123
Junior Member
 
Location: London

Join Date: Dec 2009
Posts: 2
Default

Hi Martino,

You can try absolute path of the index like below

~/where/my/data/is $ bowtie -a -v 2 /location/of/index/hg19 -c GTTCGATGAAATCTTCTTTTTCTGTTTTCACTTGGG

your index (.ebwt files) must be at /location/of/index/hg19.*.ebwt

Last edited by manoj123; 02-09-2010 at 03:39 AM.
manoj123 is offline   Reply With Quote
Old 02-09-2010, 04:54 AM   #3
martinobarenco
Junior Member
 
Location: London

Join Date: Jan 2010
Posts: 8
Default

Thanks for the prompt answer, it works. It works also with the relative path (which I had tried initially), but the full path has to be specified. ie the path to the location of the executable is not enough.
martinobarenco is offline   Reply With Quote
Old 02-09-2010, 05:46 AM   #4
martinobarenco
Junior Member
 
Location: London

Join Date: Jan 2010
Posts: 8
Default

alternatively one can specify the path in the BOWTIE_INDEXES environment variable. I did that by adding the line below in the .bashrc file:

export BOWTIE_INDEXES=absolute/path/to/bowtie/indexes

then the path does not need to be repeated in the bowtie command.

(actually, this is well documented in the bowtie manual but the n00b that I am could not figure that one out)
martinobarenco is offline   Reply With Quote
Old 01-12-2011, 11:07 PM   #5
Fumumumu
Junior Member
 
Location: Japan

Join Date: Jan 2011
Posts: 3
Default

I am struggling almost same problem.

I wanted to divide bowtie job by chrmosome in order to make grid jobs.
In the beginnig, I made each chromesome in /var/indexes/mm9masked_chrXX/index/, respectively. Each base name was mm9masked_chrXX

Bowtie could find chr1 base name, but not other base names.
What's wrong?
Each bowtie job was like this;

bowtie --sam -C --best -f -Q /path/to/data.qual /var/indexes/mm9maked_chr2/indexes/mm9masked_chr2 /path/to/data.csfasta /path/to/data_chr2.sam

Error message was as follws.
Could not locate a Bowtie index corresponding to basename "/var/indexes/mm9maked_chr2/indexes/mm9masked_chr2

$ls -l /var/indexes/mm9maked_chr2/indexes
-rw-r--r-- 1 fumumumu staff 37334426 1 11 18:15 mm9maked_chr2.1.ebwt
-rw-r--r-- 1 fumumumu staff 52439512 1 11 18:15 mm9maked_chr2.2.ebwt
-rw-r--r-- 1 fumumumu staff 2439962 1 11 18:14 mm9maked_chr2.3.ebwt
-rw-r--r-- 1 fumumumu staff 26287529 1 11 18:14 mm9maked_chr2.4.ebwt
-rw-r--r-- 1 fumumumu staff 37334426 1 11 18:17 mm9maked_chr2.rev.1.ebwt
-rw-r--r-- 1 fumumumu staff 52439512 1 11 18:17 mm9maked_chr2.rev.2.ebwt

Last edited by Fumumumu; 01-12-2011 at 11:14 PM.
Fumumumu is offline   Reply With Quote
Old 01-13-2011, 12:14 AM   #6
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 618
Default

Quote:
Originally Posted by Fumumumu View Post
I am struggling almost same problem.

I wanted to divide bowtie job by chrmosome in order to make grid jobs.
In the beginnig, I made each chromesome in /var/indexes/mm9masked_chrXX/index/, respectively. Each base name was mm9masked_chrXX

Bowtie could find chr1 base name, but not other base names.
What's wrong?
Each bowtie job was like this;

bowtie --sam -C --best -f -Q /path/to/data.qual /var/indexes/mm9maked_chr2/indexes/mm9masked_chr2 /path/to/data.csfasta /path/to/data_chr2.sam

Error message was as follws.
Could not locate a Bowtie index corresponding to basename "/var/indexes/mm9maked_chr2/indexes/mm9masked_chr2

$ls -l /var/indexes/mm9maked_chr2/indexes
-rw-r--r-- 1 fumumumu staff 37334426 1 11 18:15 mm9maked_chr2.1.ebwt
-rw-r--r-- 1 fumumumu staff 52439512 1 11 18:15 mm9maked_chr2.2.ebwt
-rw-r--r-- 1 fumumumu staff 2439962 1 11 18:14 mm9maked_chr2.3.ebwt
-rw-r--r-- 1 fumumumu staff 26287529 1 11 18:14 mm9maked_chr2.4.ebwt
-rw-r--r-- 1 fumumumu staff 37334426 1 11 18:17 mm9maked_chr2.rev.1.ebwt
-rw-r--r-- 1 fumumumu staff 52439512 1 11 18:17 mm9maked_chr2.rev.2.ebwt
Apparently it is just a typo in the actual index files:

They are called mm9maked and not mm9masked!
fkrueger is offline   Reply With Quote
Old 01-13-2011, 03:28 AM   #7
Fumumumu
Junior Member
 
Location: Japan

Join Date: Jan 2011
Posts: 3
Default

yaaaaaaaaaaaaah!





Thank you so much.....
Fumumumu is offline   Reply With Quote
Old 02-04-2011, 09:03 AM   #8
andrehorta
Member
 
Location: Brazil - Belo Horizonte - UFMG

Join Date: Jan 2011
Posts: 14
Default

Dears, i need your help!

When i typed the command: bowtie -p 4 rs4244385A

The folow message is returned:

could not locate bowtie index corresponding to basename rs4244385A

I was try to put the complete path, but not solved the problem.

This rs4244385A was generated for me, through the command bowtie-build rs4244385A.fa rs4244385A.ebwt;

Thanks
andrehorta is offline   Reply With Quote
Old 02-04-2011, 10:04 AM   #9
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,165
Default

Quote:
Originally Posted by Fumumumu View Post
I am struggling almost same problem.

I wanted to divide bowtie job by chrmosome in order to make grid jobs.
Dividing the jobs by chromosome is not a good approach to splitting up the bowtie workload. If you want to divide the alignment across multiple nodes you should split up the reads into smaller groups and align each group of reads against the entire genome of your organism.

Imagine that you have a read which matches chr3 with one mismatch and chr9 with zero mismatches. Since you are running bowtie with the --best option you would only want the perfect alignment to chr9 returned. By your method bowtie is assessing alignments to each chromosome without consideration for possible better alignments to other chromosomes. You would then need to perform some sort of secondary processing on your multiple bowtie outputs to pick the best alignment(s) among all of the per chromosome alignments.

Split your reads into however many jobs you want run, align each group to the total genome and then merge the resulting BAM files using samtools.
kmcarr is offline   Reply With Quote
Old 03-28-2011, 03:55 AM   #10
stoker
Member
 
Location: Poland

Join Date: Oct 2010
Posts: 17
Default

I have reversed problem - my bowtie runs well with reference name (ex. hg19) but does not work with the full path of indexes, which I need for my local Galaxy.

This does not work:
bowtie -q -p 4 -S --sam-nohead /.../bowtie-0.12.7/indexes/test_ref /.../test_file.fastq

This works:
bowtie -q -p 4 -S --sam-nohead test_ref /.../test_file.fastq

Any suggestions how to make my full path reference working?
__________________
Tomasz Stokowy
www.sequencing.io.gliwice.pl
stoker is offline   Reply With Quote
Old 09-13-2012, 02:19 AM   #11
giampe
Member
 
Location: Bari, Italy

Join Date: Aug 2009
Posts: 22
Default

hi all,
I'm writing my problem about running of bowtie in this thread, even if I'm using bowtie to run another program named Paparazzi (Vodovar et al 2011).
the error coming out is:

[user1@netlab01:~/data_from_testuser1]$ paparazzi /home/user1/data_from_testuser1/paparazzi_new_version/paparazzi_conf_file.txt
P1B_Y_trim_clip.fastq GPGV
Creating target directories
Filtering host-derived reads
Could not locate a Bowtie index corresponding to basename "path_to_reference_genome_bowtie_library_including_library_basename"
Command: bowtie -v 0 --threads 4 --solexa-quals --quiet --un ../filtered/P1B_Y_trim_clip.fastq_unmatched.fq path_to_reference_genome_bowtie_library_including_library_basename /home/user1/data_from_testuser1/LIBRERIE_OTTOBRE/P1B/36trimmed/P1B_Y_trim_clip.fastq
Died at /home/user1/bin/paparazzi line 80, <$fh> line 1.


I'm frustated everything seems ok!
giampe is offline   Reply With Quote
Old 06-10-2014, 06:11 AM   #12
carolW
Senior Member
 
Location: US

Join Date: Apr 2013
Posts: 103
Default

Hi
Although I use the right path to the index file, bowtie can't find it

/home/carolw/Desktop/bowtie-1.0.1/bowtie -x /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index -r /home/carolw/rawSeq -S /home/carolw/rawSeq.sam

Could not locate a Bowtie index corresponding to basename " /home/carolw/rawSeq"
Command: /home/carolw/Desktop/bowtie-1.0.1/bowtie -x /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index -r -S /home/carolw/rawSeq /home/carolw/rawSeq.sam

ls /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index*
/home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.1.ebwt
/home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.2.ebwt
/home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.3.ebwt
/home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.4.ebwt
/home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.rev.1.ebwt
/home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.rev.2.ebwt
carolW is offline   Reply With Quote
Old 06-10-2014, 06:27 AM   #13
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,966
Default

Order of options provided for bowtie are important. I am not sure if -x is needed and -r needs to be followed by your read files. -S needs to go with your sam file.
GenoMax is online now   Reply With Quote
Old 06-10-2014, 06:30 AM   #14
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

The -x option is for bowtie2. You want
Code:
/home/carolw/Desktop/bowtie-1.0.1/bowtie -r -S /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index /home/carolw/rawSeq /home/carolw/rawSeq /home/carolw/rawSeq.sam
dpryan is offline   Reply With Quote
Old 06-10-2014, 09:13 AM   #15
carolW
Senior Member
 
Location: US

Join Date: Apr 2013
Posts: 103
Default

yes, I removed -x and it works

many thx
carolW is offline   Reply With Quote
Old 02-27-2016, 08:49 AM   #16
Sow
Member
 
Location: Washington

Join Date: Feb 2016
Posts: 16
Default could not locate bowtie index corresponding to biobase "e_coli"

Hi,

I am trying to use bowtie from my environmental variable-
$ Module load bio/bowtie/1.1.2
$ bowtie e_coli reads/e_coli_1000.fq
But it returns me the following:
Could not locate a Bowtie index corresponding to basename "e_coli"
Command: bowtie --wrapper basic-0 e_coli reads/e_coli_1000.fq

I thought e_coli indices comes with the package - so this this should be a easy command to run.
Could someone guide me about what is the right command?
Sow is offline   Reply With Quote
Old 02-27-2016, 09:17 AM   #17
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

Environment modules only put the executable in the PATH, nothing more. You'll still need to tell bowtie where the indices are (assuming they were even installed).
dpryan is offline   Reply With Quote
Old 02-27-2016, 05:58 PM   #18
Sow
Member
 
Location: Washington

Join Date: Feb 2016
Posts: 16
Default

Thank you so much! I had to specify my home directory for the genome and the read file.
Sow is offline   Reply With Quote
Reply

Tags
bowtie, file, index, path

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:57 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO