SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
MAQ problems sasignor Bioinformatics 12 06-17-2011 10:21 AM
problems with MAQ shayoni_seq Bioinformatics 0 02-06-2011 10:36 PM
Help - MAQ getting started inesdesantiago Bioinformatics 12 04-24-2010 10:52 PM
Getting Started n2hasan Bioinformatics 0 09-05-2009 12:59 PM
still got Maq problems alig Bioinformatics 9 06-05-2009 02:32 PM

Reply
 
Thread Tools
Old 10-23-2008, 05:41 PM   #1
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Unhappy Maq problems getting started

I have downloaded Maq & am trying to get the program to work.
When I try to run Maq I get this output

maq.pl demo ref.fasta calib-36.dat
-- CMD: mkdir -p maqdemo
-- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
calib-30.dat > maqdemo/true.snp
> > /usr/bin/maq: line 1: .": command not found
> > /usr/bin/maq: line 2: .": command not found
> > /usr/bin/maq: line 3: .": command not found
> > /usr/bin/maq: line 4: .": command not found
> > /usr/bin/maq: line 5: .de: command not found
> > /usr/bin/maq: line 6: .br: command not found
> > /usr/bin/maq: line 7: .if: command not found
> > /usr/bin/maq: line 8: .ne: command not found
> > /usr/bin/maq: line 9: .PP: command not found
> > /usr/bin/maq: line 10: fB\simulatefR: command not found
> > /usr/bin/maq: line 11: .PP: command not found
> > /usr/bin/maq: line 12: ..: command not found
> > /usr/bin/maq: line 13: syntax error near unexpected token `('
> > /usr/bin/maq: line 13: `.de Sp \" Vertical space (when we can't use .PP)'
> > ** fail to run command '/usr/bin/maq simulate -N 1000000 maqdemo/r1.fq
> > maqdemo/r2.fq ref.fasta calib-30.dat > maqdemo/true.snp' at /usr/bin/
> > maq.pl line 842.


If I try to run maq.pl easyrun -d outdir ref.fasta reads.fastq command I get

-- CMD: /usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null
** fail to run command '/usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null' at /usr/bin/maq.pl line 842.

I save my ref.fasta file in Bbedit as Unix format. I'm not a bioinformatician
so am struggling.

any help would be greatly appreciated

alig
alig is offline   Reply With Quote
Old 10-23-2008, 07:10 PM   #2
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,358
Default

Hey Alig,

here is the output from that command when it's running correctly:

Code:
eco@******:~/perl/maq$ maq.pl demo testref.fa calib-36.dat 
-- CMD: mkdir -p maqdemo
-- CMD: /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq testref.fa calib-36.dat > maqdemo/true.snp
-- 1 sequences, total length: 312
-- CMD: /usr/local/bin/maq fasta2bfa testref.fa maqdemo/ref.bfa
-- 1 sequences have been converted.
-- CMD: (cd maqdemo; /usr/local/bin/maq.pl easyrun -p -d easyrun ref.bfa r1.fq r2.fq)
-- CMD: ln -sf /Users/eco/perl/maq/maqdemo/ref.bfa easyrun/ref.bfa
-- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /Users/eco/perl/maq/maqdemo/r1.fq easyrun/read1
-- finish writing file 'easyrun/read1@1.bfq'
-- 1000000 sequences were loaded.
-- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /Users/eco/perl/maq/maqdemo/r2.fq easyrun/read2
-- finish writing file 'easyrun/read2@1.bfq'
-- 1000000 sequences were loaded.
-- CMD: (cd easyrun; /usr/local/bin/maq map  -n 2 -e 70 aln@1.map ref.bfa read1@1.bfq read2@1.bfq 2> aln@1.map.log)
-- CMD: (cd easyrun; mv aln@1.map all.map)
-- CMD: (cd easyrun; /usr/local/bin/maq mapcheck ref.bfa all.map > mapcheck.txt)
[ma_mapcheck] processing refernces...
-- CMD: (cd easyrun; /usr/local/bin/maq assemble -N 2 -Q 60 consensus.cns ref.bfa all.map 2> assemble.log)
-- CMD: /usr/local/bin/maq cns2fq easyrun/consensus.cns > easyrun/cns.fq
-- CMD: /usr/local/bin/maq cns2snp easyrun/consensus.cns > easyrun/cns.snp
-- CMD: /usr/local/bin/maq cns2win easyrun/consensus.cns > easyrun/cns.win
-- CMD: /usr/local/bin/maq indelsoa easyrun/ref.bfa easyrun/all.map > easyrun/cns.indelse
-- CMD: /usr/local/bin/maq indelpe easyrun/ref.bfa easyrun/all.map > easyrun/cns.indelpe
-- CMD: /usr/local/bin/maq.pl SNPfilter -q 40 -w 5 -N 2 -f easyrun/cns.indelse -F easyrun/cns.indelpe -d 3 -D 256 -n 20 -Q60 easyrun/cns.snp > easyrun/cns.final.snp
-- 0 potential soa-indels pass the filter.
-- 0 potential pe-indels pass the filter.
-- CMD: (cd easyrun; ln -s cns.final.snp cns.filter.snp)
-- CMD: /usr/local/bin/maq.pl statmap easyrun/*.map.log

-- == statmap report ==

-- # single end (SE) reads: 0
-- # mapped SE reads: 0 (/ 0 = NA%)
-- # paired end (PE) reads: 2000000
-- # mapped PE reads: 2000000 (/ 2000000 = 100%)
-- # reads that are mapped in pairs: 1999942 (/ 2000000 = 99.99%)
-- # Q>=30 reads that are moved to meet mate-pair requirement: 0 (/ 1999942 = 0%)
-- # Q<30 reads that are moved to meet mate-pair requirement: 0 (0%)

-- CMD: (cd maqdemo; /usr/local/bin/maq simustat easyrun/all.map > eval.simustat)
-- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl sub -p eval.sub true.snp true.snp easyrun/cns.filter.snp)
-- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl indelpe true.snp easyrun/cns.indelpe > eval.indelpe)
-- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl indelsoa true.snp easyrun/cns.indelse > eval.indelse)
++ maqdemo/easyrun/cns.filter.snp gives the SNPs that passes most of filters.
++ maqdemo/easyrun/cns.final.snp is the high-quality subset of the previous SNPs.
++ maqdemo/easyrun/mapcheck.txt gives some statistics about qualities.
++ maqdemo/true.snp contains all variants used in simulation.
++ maqdemo/eval.* give various benchmarks. Their formats will be documented later.
First, I assume you did indeed download maq-data (the calib-36.dat file), here is the output when that file isn't there.

Code:
-- CMD: mkdir -p maqdemo
-- CMD: /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp
[maq_simulate] cannot open parameter file 'calib-36.dat'
Assertion failed: (fpout1 && fpout2 && fp_fa && fp_par), function maq_simulate, file simulate.c, line 365.
sh: line 1:  5836 Abort trap              /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp
** fail to run command '/usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp' at /usr/local/bin/maq.pl line 842.
Second, I would recreate a small reference from scratch (I just did what you describe with bbedit and it works fine). Could be either non-printing characters (bad line endings), or a strange character in the name definition line. Post up the header and first few lines.

Last, have you checked that all the scripts are in either the same directory or your path (maq.pl, and maq_eval.pl, should both work standalone).
ECO is offline   Reply With Quote
Old 10-23-2008, 07:11 PM   #3
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,358
Default

Just noticed this...something is wrong with either your data file or your version of maq.pl. See bolded region in your error message below (and compare to my successful run above)...it's launching with the wrong filename for the .dat file...

My hints above were with 0.6.8. The only version I've found where most things work well for me.

Quote:
Originally Posted by alig View Post
I have downloaded Maq & am trying to get the program to work.
When I try to run Maq I get this output

maq.pl demo ref.fasta calib-36.dat
-- CMD: mkdir -p maqdemo
-- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
calib-30.dat > maqdemo/true.snp
> > /usr/bin/maq: line 1: .": command not found
> > /usr/bin/maq: line 2: .": command not found
> > /usr/bin/maq: line 3: .": command not found
> > /usr/bin/maq: line 4: .": command not found
> > /usr/bin/maq: line 5: .de: command not found
> > /usr/bin/maq: line 6: .br: command not found
> > /usr/bin/maq: line 7: .if: command not found
> > /usr/bin/maq: line 8: .ne: command not found
> > /usr/bin/maq: line 9: .PP: command not found
> > /usr/bin/maq: line 10: fB\simulatefR: command not found
> > /usr/bin/maq: line 11: .PP: command not found
> > /usr/bin/maq: line 12: ..: command not found
> > /usr/bin/maq: line 13: syntax error near unexpected token `('
> > /usr/bin/maq: line 13: `.de Sp \" Vertical space (when we can't use .PP)'
> > ** fail to run command '/usr/bin/maq simulate -N 1000000 maqdemo/r1.fq
> > maqdemo/r2.fq ref.fasta calib-30.dat > maqdemo/true.snp' at /usr/bin/
> > maq.pl line 842.


If I try to run maq.pl easyrun -d outdir ref.fasta reads.fastq command I get

-- CMD: /usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null
** fail to run command '/usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null' at /usr/bin/maq.pl line 842.

I save my ref.fasta file in Bbedit as Unix format. I'm not a bioinformatician
so am struggling.

any help would be greatly appreciated

alig
ECO is offline   Reply With Quote
Old 10-23-2008, 07:13 PM   #4
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,358
Default

last but not least I'm going to move this to the Bioinformatics forum to get more eyes on it.
ECO is offline   Reply With Quote
Old 10-23-2008, 09:00 PM   #5
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Default

Hi Eco,

Firstly thank you very much for your quick reply.

I did download maq-data (calib-36.dat file) And very sorry for the confusion but I just cut & pasted the output from an email I sent to Heng Li who said I was using the wrong .dat file (calib-30.dat) for maq-0.7.0. But using calib-36.dat made no difference to the output.

This is the first few lines of my ref. fasta file
>Salmonella typhi 45kb
aaggaatttttttgactgggtccgggagacgtacctaaaatttaacaattcttggggagg
tggctgggaaaatgaggtgccccaaataatcccgatgatgaatgatgaaggattgctgga
gtgcccattttgcggttcgctgaaggtttacctgttcgacgagttggttttatctcatgg
gtcttgctcgtcatgcgatgcgcgcacagatgaccactttgatgcttctatggctgtgaa
gtcatggaacacccgcaacgggcacgtctacaccgctgacgacttcagtcgggcagcaga

all the scripts are in the same usr/bin directory.

But I did have to rename the maq.1 script to maq & am assuming that it is an executable.

alig
alig is offline   Reply With Quote
Old 10-23-2008, 11:10 PM   #6
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,358
Default

Hrm. I had nothing but problems with 0.7.0 and 0.7.1, so went back to 0.6.8.

Not sure why you renamed that script...maq.1 looks like the man pages for the program. That's undoubtedly your problem there...it's trying to execute whatever markup is used for man pages.

Did you compile maq?
ECO is offline   Reply With Quote
Old 10-26-2008, 08:16 AM   #7
xuer
Member
 
Location: germany

Join Date: Sep 2008
Posts: 17
Default

maybe you have fixed the froblem.if not,
look the command below, are you using calib-30.dat or calib-36.dat?

maybe it is the reason. if you can see the message soon.

-- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
calib-30.dat > maqdemo/true.snp
xuer is offline   Reply With Quote
Old 10-26-2008, 05:06 PM   #8
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Default maq problems

I renamed the script...maq.1 as it was looking for maq in the same directory as maq.pl & maq_eval.pl & couldn't find maq as there wasn't a file of that name I assumed.

That is probably my problem then if it is actually the man pages. I might try an earlier version then - 0.6.8

thanks a lot for all your help so far everyone

alig
alig is offline   Reply With Quote
Old 10-26-2008, 06:16 PM   #9
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Default Maq problems

I did compile maq, but I can never find a maq executable

The maq.pl & maq_eval.pl scripts come in maqview I think, & I have them

but there is only maq.1 not maq so I always get the ouput

maq.pl easyrun -d outdir ref.fasta reads.fastq
[gwhich] fail to find executable maq anywhere. at /usr/bin/maq.pl line 883.
** Cannot find 'maq' executable. at /usr/bin/maq.pl line 77.

alig
alig is offline   Reply With Quote
Old 10-27-2008, 12:51 AM   #10
andpet
Member
 
Location: Germany

Join Date: Jul 2008
Posts: 26
Default getting maq started

Hi,

the file maq.1 is definitly the man page, so it makes no sense to rename it to get the executable. The missing executable seems to be the problem

Maybe it is the best if you recompile your maq version (make clean first then ./configure; make; make install) and post any errors that occurred ?

Andreas
andpet is offline   Reply With Quote
Old 10-29-2008, 08:42 AM   #11
valeu
Member
 
Location: Paris

Join Date: Sep 2008
Posts: 69
Default

Quote:
Originally Posted by ECO View Post
Hrm. I had nothing but problems with 0.7.0 and 0.7.1, so went back to 0.6.8.

Did you compile maq?
Oh thank you so much! I tried everything to make maq 0.7.1 work! I managed to compile it but then I got "Segmentation error" trying to run it..
And with 0.6.8 it's fine!

Valentina
valeu is offline   Reply With Quote
Old 10-29-2008, 09:05 PM   #12
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Default

Hi Andreas,

When I type 'make' I get this error message

/Documents/Alison/Maq/maq-0.6.8 jozefgecz$ make
cd . && /bin/sh /Users/jozefgecz/Documents/Alison/Maq/maq-0.6.8/missing --run autoheader
aclocal.m4:17: error: this file was generated for autoconf 2.61.
You have another version of autoconf. If you want to use that,
you should regenerate the build system entirely.
aclocal.m4:17: the top level
autom4te: /usr/bin/gm4 failed with exit status: 63
autoheader: /usr/bin/autom4te failed with exit status: 63
WARNING: `autoheader' is probably too old. You should only need it if
you modified `acconfig.h' or `configure.ac'. You might want
to install the `Autoconf' and `GNU m4' packages. Grab them
from any GNU archive site.

......and at the very end - ld64-62.1 failed: symbol(s) not found
collect2: ld returned 1 exit status
make[1]: *** [maq] Error 1
make: *** [all] Error 2


I have downloaded & compiled autoconf 2.61 & GNU M4 1.4.9 but it still seems to be finding the built-ins (You have another version of autoconf) & not the newer version just installed.

alig
alig is offline   Reply With Quote
Old 10-29-2008, 09:17 PM   #13
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,358
Default

Looks like that's a Mac...have you installed the developers tools ("Xcode" if i remember correctly) ??
ECO is offline   Reply With Quote
Old 10-29-2008, 09:37 PM   #14
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Default Maq problems

Hi Eco,

Yes it's a Mac OS X 10.4.11 & so has Xcode 2.4.1 installed on it.

but the autoconf is only version 2.59 & gm4 is version 1.4.2

So I was trying to install more recent versions. But it's still looking at the built-ins & not the newer more recently installed versions

alig
alig is offline   Reply With Quote
Old 10-30-2008, 09:13 PM   #15
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Angry Maq problems

I have just noticed this error when compiling maq-0.6.8 with 'make'

ld64 warning: in /usr/lib/libz.dylib, file is not of required architecture

I am running it on a PowerPC G4 Mac but also get the same error on a G5

even though the Maq webpage says that - "Compiling as a 32bit executable should work but the speed will be affected"

Do I just need to somehow get different libraries or should I just give up now !!!

exasperated alig
alig is offline   Reply With Quote
Old 11-04-2008, 04:24 AM   #16
andpet
Member
 
Location: Germany

Join Date: Jul 2008
Posts: 26
Smile maq getting started

Ahhh,

sorry but I usually don't work with Macs so I can't really help you. However I have some thoughts about your last error message:

It seems that you are trying to compile a 64bit version of maq by linking a 32bit library which can't work. You could try two things:

1)
make clean
set the environment variable CC to "gcc -m32" (I assume gcc is your compiler)
./configure
make

2)
make clean
edit the file Makefile.generic and look for CFLAGS; change -m64 into -m32
make -f Makefile.generic


Hmm, I don't know if that really helps you. You could also ask the author of maq for a compiled binary for your Mac.

Maybe one of the other mac users in this forum can help you out ...

Wish you luck ,

Andreas
andpet is offline   Reply With Quote
Old 11-05-2008, 08:23 PM   #17
alig
Member
 
Location: adelaide

Join Date: Sep 2008
Posts: 43
Default

To Andreas,

actually you did help me, so thank you, thank you.

you are quite correct that I was trying to compile a 64bit version of maq by linking a 32bit library.

Editing the Makefile.generic at CFLAGS did solve the problem.

I now just have to find some example data to trial the program with while I wait for our sequence to come.

thanks very much again

alig
alig is offline   Reply With Quote
Old 04-16-2009, 08:31 PM   #18
vibhavashukla
Junior Member
 
Location: india

Join Date: Feb 2009
Posts: 1
Default easy run failed

hi while running maq-0.6.8 in easy run command i am getting this error msg.
fail to run command '(cd easyrun; /usr/local/bin/maq map -n 2 -e 70 -u unmap1@8000001.txt aln1@8000001.map ref.bfa read1@8000001.bfq 2> aln1@8000001.map.log)' at ../maq-0.6.8/scripts/maq.pl line 842
can any one tell me the possible reason for this failed msg?
vibhavashukla is offline   Reply With Quote
Old 10-29-2009, 06:09 AM   #19
kunalfab
Junior Member
 
Location: India

Join Date: Oct 2009
Posts: 2
Default Same error here...

-- 0 potential soa-indels pass the filter.
-- 2 potential pe-indels pass the filter.
-- CMD: (cd easyrun; ln -s cns.final.snp cns.filter.snp)
ln: creating symbolic link `cns.filter.snp': File exists
** fail to run command '(cd easyrun; ln -s cns.final.snp cns.filter.snp)' at /usr/local/bin/maq.pl line 842.
** fail to run command '(cd maqdemo; /usr/local/bin/maq.pl easyrun -p -d easyrun ref.bfa r1.fq r2.fq)' at /usr/local/bin/maq.pl line 842.

I am new to MAQ... as well as to this forum, so kindly forgive me if i go wrong somewhere...
and kindly help in solving the above error..
kunalfab is offline   Reply With Quote
Old 11-04-2009, 11:21 AM   #20
andpet
Member
 
Location: Germany

Join Date: Jul 2008
Posts: 26
Default

--> ln: creating symbolic link `cns.filter.snp': File exists <--

The script tries to create a link cns.filter.snp to the file cns.final.snp. However this is not possible if the link already exists. A linux thing ...

Simply remove all files that were created by an previous maq.pl run and try again ...

Andreas
andpet is offline   Reply With Quote
Reply

Tags
maq, problems

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:09 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO