
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
bowtie index problem (bowtie-build and then bowtie-inspect) tgenahmet Bioinformatics 4 09-10-2013 11:51 AM
Bowtie --sam option - includes non-aligned reads? ledsall Bioinformatics 3 02-24-2013 12:31 AM
Bowtie option --best --strata for unique mapper in the genome StephaniePi83 Bioinformatics 1 03-27-2012 12:29 PM
bowtie -m option frymor Bioinformatics 1 11-03-2011 06:58 AM
Option for bowtie-build ljxue Bioinformatics 2 08-11-2010 09:16 PM

Thread Tools
Old 04-06-2012, 01:12 AM   #1
Location: France

Join Date: Sep 2011
Posts: 52
Default bowtie option -l -n

Hello everybody,

I have to map small reads (15 to 29 nt ) on transcripts in order to find gene that are targetted by a small class of ncRNA. nothing in known about this targetting, but i need to put a seed length of 16nt with no mismatches.
Attached is a picture showing the kind of targetting we are searching for.
I run bowtie with the following option :
bowtie -l 16 -n 0 -v 3 --nofw -t transcript_clip -c AATTGAATAAATATATGTCAG
, but no alignement is returned.
I would like to know if an option exist to tell bowtie that only the seed is take into account during the mapping, not the remaining sequence ...

Thanks in advance for your help.
Attached Images
File Type: jpg Capture01.jpg (10.1 KB, 11 views)
StephaniePi83 is offline   Reply With Quote
Old 04-06-2012, 04:43 AM   #2
Location: Pittsburgh, PA

Join Date: Feb 2011
Posts: 49

'-v' and '-n' are mutually exclusive and bowtie will not run. So to set the number of mismatches in your seed it would just be '-n 0'

I hope this helps!

Last edited by twaddlac; 04-06-2012 at 04:44 AM. Reason: forgot to say something
twaddlac is offline   Reply With Quote
Old 04-06-2012, 04:48 AM   #3
Location: France

Join Date: Sep 2011
Posts: 52

Yes i know, but even when i run
bowtie -l 16 -n 0 --nofw -t transcript_clip -c AATTGAATAAATATATGTCAGC
i have no alignment.
I was thinking that bowtie2 can do this but it seems not .... anyone can help me ?

Last edited by StephaniePi83; 04-06-2012 at 06:46 AM.
StephaniePi83 is offline   Reply With Quote
Old 04-07-2012, 11:54 PM   #4
Location: Oregon

Join Date: Feb 2011
Posts: 29

I have used
bowtie --best -strata ...

in that situation with success
tomc is offline   Reply With Quote
Old 04-09-2012, 11:46 PM   #5
Location: France

Join Date: Sep 2011
Posts: 52

I solve the problem by setting a high value to the maximum permitted total of quality values :
bowtie -l 16 -n 0 -e 1000 --nofw  transcript_clip -c AATTGAATAAATATATGTCAGCC
StephaniePi83 is offline   Reply With Quote
Old 01-22-2014, 05:13 AM   #6
Location: Italy

Join Date: Aug 2012
Posts: 27

Hey Stephanie,

why you are suppose to have --nofw option ???
unique379 is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 07:24 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO