SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
can small rnaseq data be analyzed like rnaseq data? PFS Bioinformatics 5 05-02-2017 08:16 AM
who coined RNAseq? RNAseq as an alignment first approach only brachysclereid Bioinformatics 3 01-10-2012 12:17 PM
new to RNASeq Navi Introductions 3 06-10-2011 07:40 AM
trying to become an RNAseq-er mapplebe Introductions 1 05-25-2011 01:26 PM
new to RNAseq shenghua Introductions 0 06-03-2010 10:38 AM

Reply
 
Thread Tools
Old 03-28-2011, 08:41 AM   #1
JoaoMoura
Junior Member
 
Location: Barcelona

Join Date: Mar 2011
Posts: 2
Default RNASeq - overrepresent sequences

Hey guys!

First of all, I'm sorry If I'm puting this question in the wrong section, but I'm new to this forum.

Well, I'm doing DE with RNASeq and after doing some QA and QC (removed the solexa adapter and trimmed the reads) I still have an 2 overrepresented sequences from most of my fasta files, which are:

CGATGAAGAACGCAGCGAAATG

CCCCCTGGAATACCAAGGGGCG

Do you have any idea what they are?

Thanks a lot!
JoaoMoura is offline   Reply With Quote
Old 03-28-2011, 10:19 AM   #2
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Were any PCR primers used in preparing the sample?
maubp is offline   Reply With Quote
Old 03-28-2011, 10:58 AM   #3
JoaoMoura
Junior Member
 
Location: Barcelona

Join Date: Mar 2011
Posts: 2
Default

Hi!

Actually I'm not sure. But background is not biological, but I tried looking in the article and suplementary material, but I didn't find anything.

This is the article:

http://www.plosgenetics.org/article/...gen.1000299#s5
JoaoMoura is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO