Hey guys!
First of all, I'm sorry If I'm puting this question in the wrong section, but I'm new to this forum.
Well, I'm doing DE with RNASeq and after doing some QA and QC (removed the solexa adapter and trimmed the reads) I still have an 2 overrepresented sequences from most of my fasta files, which are:
CGATGAAGAACGCAGCGAAATG
CCCCCTGGAATACCAAGGGGCG
Do you have any idea what they are?
Thanks a lot!
First of all, I'm sorry If I'm puting this question in the wrong section, but I'm new to this forum.
Well, I'm doing DE with RNASeq and after doing some QA and QC (removed the solexa adapter and trimmed the reads) I still have an 2 overrepresented sequences from most of my fasta files, which are:
CGATGAAGAACGCAGCGAAATG
CCCCCTGGAATACCAAGGGGCG
Do you have any idea what they are?
Thanks a lot!
Comment