SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SAM to CUFFLINKS SAM format repinementer Bioinformatics 4 03-15-2012 08:53 AM
Looking process to convert gff3 format into ace format or sam format andylai Bioinformatics 1 05-17-2011 02:09 AM
New: updated SpliceMap supports SAM format/cufflinks john_mu Bioinformatics 9 05-29-2010 12:45 PM
New: updated SpliceMap supports SAM format/cufflinks john_mu General 0 05-20-2010 05:11 PM
Helicos sequencing machine data & format required balamudiam Helicos / Direct Genomics 4 10-27-2009 08:28 PM

Reply
 
Thread Tools
Old 10-15-2009, 02:19 AM   #1
arthur.yxt
Member
 
Location: Berlin

Join Date: Oct 2009
Posts: 10
Default SAM result format required in cufflinks

Hi all,

Tophat is a great, but it seems not working so well with Cufflinks. As Cufflinks require the .SAM result containing the "XS:A:" field and Tophat don't provide this, I will have to add this field to the end of each line of .sam file.

But after I did this, cufflinks warned me with "XA attribute not supported". And "XA" attribute is there from Tophat. Should I remove "XA" field or put "XS" field in the position of "XA"?

Thanks!
arthur.yxt is offline   Reply With Quote
Old 01-05-2010, 08:02 AM   #2
mmanrique
Member
 
Location: Granada, Spain

Join Date: Dec 2009
Posts: 12
Default

Hi Arthur,

have you tried getting .SAM files using Bowtie (http://bowtie-bio.sourceforge.net/index.shtml) instead of Tophat? I think it would work although I haven't tried it yet.
mmanrique is offline   Reply With Quote
Old 02-02-2010, 05:52 PM   #3
calliopsis
Junior Member
 
Location: connecticut

Join Date: Jul 2009
Posts: 2
Default cufflinks error

Hi~

I tried the new version bowtie-0.12.1 to get .sam result, and then use it as the input file of Cufflinks, there is the same error: XA attribute not supported, how can I fix it?
calliopsis is offline   Reply With Quote
Old 02-26-2010, 03:57 AM   #4
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default XA attribute not supported cufflinks

I get the same error message with SAM produced by bowtie version 0.11.3.

Can you just do a search and replace on the file as suggested by calliopsis?
staylor is offline   Reply With Quote
Old 02-26-2010, 06:33 AM   #5
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default

The way round this seems to be to get a sorted SAM file and remove the offending columns.

I converted my SAM file to a BAM file, sorted the BAM file using samtools, and then with the resulting all.sorted.bam removed the offending columns. Thus:

samtools view all.sorted.bam | cut -f1-11 > all.sorted.sam

Then cufflinks will process this without error.
staylor is offline   Reply With Quote
Old 02-26-2010, 09:11 AM   #6
Cole Trapnell
Senior Member
 
Location: Boston, MA

Join Date: Nov 2008
Posts: 212
Default

Quote:
Originally Posted by arthur.yxt View Post
Hi all,

Tophat is a great, but it seems not working so well with Cufflinks. As Cufflinks require the .SAM result containing the "XS:A:" field and Tophat don't provide this, I will have to add this field to the end of each line of .sam file.

But after I did this, cufflinks warned me with "XA attribute not supported". And "XA" attribute is there from Tophat. Should I remove "XA" field or put "XS" field in the position of "XA"?

Thanks!
Which versions of TopHat, Cufflinks, and Bowtie are you working with? As of TopHat 1.0.11, all spliced alignments should have the XS "source strand" attribute attached. As of Cufflinks 0.8.0, SAM attributes other than XS and NM are silently ignored, and should produce no warnings.
Cole Trapnell is offline   Reply With Quote
Old 02-26-2010, 09:29 AM   #7
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default

0.11.3.

Will doing the cut affect the accuracy of the cufflinks calls?
staylor is offline   Reply With Quote
Old 02-26-2010, 06:13 PM   #8
Cole Trapnell
Senior Member
 
Location: Boston, MA

Join Date: Nov 2008
Posts: 212
Default

Quote:
Originally Posted by staylor View Post
0.11.3.

Will doing the cut affect the accuracy of the cufflinks calls?
Definitely. Without those attributes, Cufflinks can't place transfrags on a strand, and if you are assembling transcripts (i.e. not using an annotation), it will merge genes that overlap on opposite strands. Even if you are using an annotation, the quantitation accuracy could be reduced. You should do your best to feed Cufflinks spliced alignments that are stranded with the XS. The upcoming version 0.8.2 will complain loudly when you omit them.
Cole Trapnell is offline   Reply With Quote
Old 02-28-2010, 07:34 AM   #9
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default

Quote:
Originally Posted by Cole Trapnell View Post
Definitely. Without those attributes, Cufflinks can't place transfrags on a strand, and if you are assembling transcripts (i.e. not using an annotation), it will merge genes that overlap on opposite strands. Even if you are using an annotation, the quantitation accuracy could be reduced. You should do your best to feed Cufflinks spliced alignments that are stranded with the XS. The upcoming version 0.8.2 will complain loudly when you omit them.
Ok I will upgrade bowtie asap.

In the meantime is there a simple way I can process the SAM/bowtie output to be compatible with this version of cufflinks or do I just have to run the searches again?
staylor is offline   Reply With Quote
Old 03-05-2010, 10:29 AM   #10
thinkRNA
Member
 
Location: Carlsbad,CA

Join Date: Jan 2010
Posts: 94
Default

Quote:
Originally Posted by Cole Trapnell View Post
You should do your best to feed Cufflinks spliced alignments that are stranded with the XS. The upcoming version 0.8.2 will complain loudly when you omit them.
Can one get bowtie to output strand information? I don't want to use tophat as of now because I am only interested in differential expression and not splicing. However, I want to make sure my reads are getting aligned to the correct strand and that cufflinks is taking this into consideration.
thinkRNA is offline   Reply With Quote
Old 03-05-2010, 10:50 AM   #11
Cole Trapnell
Senior Member
 
Location: Boston, MA

Join Date: Nov 2008
Posts: 212
Default

If the reads are strand specific, then you can simply run the forward reads against the forward strand, and attach the XS:A:+ attribute ex post facto, and similarly against the reverse strand.

However, I strongly recommend NOT using Bowtie alignments with Cufflinks to calculate differential expression, even at the gene level. Cufflinks' calculates expression for genes by adding the relative abundances of the individual transcripts, and these are vastly more difficult to calculate without spliced reads. I urge you to use TopHat, even with novel junction discovery disabled if needed, in order to align your reads.
Cole Trapnell is offline   Reply With Quote
Old 03-05-2010, 10:58 AM   #12
thinkRNA
Member
 
Location: Carlsbad,CA

Join Date: Jan 2010
Posts: 94
Default

Thanks so much for your prompt reply. I will begin using tophat spliced alignment now. I would like to "customize" my tophat runs with different bowtie parameters. I think someone in this forum has suggested how to do this (by editing the tophat python script), but it would be helpful as an option in tophat. Thanks a million!

Last edited by thinkRNA; 03-05-2010 at 11:01 AM.
thinkRNA is offline   Reply With Quote
Old 10-18-2010, 06:03 AM   #13
Pejman
Member
 
Location: Switzerland

Join Date: Jul 2010
Posts: 23
Default

Quote:
Originally Posted by Cole Trapnell View Post
However, I strongly recommend NOT using Bowtie alignments with Cufflinks to calculate differential expression, even at the gene level. Cufflinks' calculates expression for genes by adding the relative abundances of the individual transcripts, and these are vastly more difficult to calculate without spliced reads. I urge you to use TopHat, even with novel junction discovery disabled if needed, in order to align your reads.
Dear Cole
Could you please elaborate how much of a catastrophe would that be to use Bowtie -> Cufflinks instead of Tophat -> Cufflinks, particularly in case of no-new-junctions?

I'm using single end 30bp SOLiD RNAseq colorspace reads from Human samples, which does not quite fit to Tophat defaults. I'm using both tophat and cufflinks only with given known junctions. The problem is that with Tophat I get around 5 times less sequences aligned, compared to Bowtie, and there is not much flexibility in Tophat to manipulate the alignment settings.
Pejman is offline   Reply With Quote
Old 10-18-2010, 07:12 AM   #14
zee
NGS specialist
 
Location: Malaysia

Join Date: Apr 2008
Posts: 249
Default

So according to Cole (Cufflinks author) we shouldn't be using Cufflinks with SAM results from other alignments.
If I am using BWA to map my reads I am going to potentially lose out because there are no XS tags in my SAM format.
zee is offline   Reply With Quote
Old 10-18-2010, 07:28 AM   #15
Pejman
Member
 
Location: Switzerland

Join Date: Jul 2010
Posts: 23
Default

Quote:
Originally Posted by zee View Post
So according to Cole (Cufflinks author) we shouldn't be using Cufflinks with SAM results from other alignments.
If I am using BWA to map my reads I am going to potentially lose out because there are no XS tags in my SAM format.
Well, missing tags are not essential problem, cuz you can't run cufflinks without them With bowtie you can easily make a compatible format, the question is how much sense it makes to do so. The problem with generic alignment programs like Bowtie is that they essentially do not take splice junctions into account while it is the core idea in Cufflinks expression estimation. well, at least thats my impression!
Pejman is offline   Reply With Quote
Old 11-12-2010, 01:11 AM   #16
repinementer
Member
 
Location: asia

Join Date: Dec 2009
Posts: 80
Default

Hi guys does any one know how to convert this format to SAM ?
Author of this paper mentioned this is SAM format but it is not working with Cufflinks.
And it is not looking like the SAM format mentioned in SAM website.
Any help would be appreciated!

Quote:
head 3125_8.sam
IL6_3125:8:58:1625:1479 67 clone::AL662826.11:1:145431:1 1261 0 37M * 0 247 AAAAGGAGTAGGCAGGAAAACAGTCAATTATGGATTC ?BBCBBBB@<BBBBCB@A@?B?B>@A@B@BABB?B@? MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
IL6_3125:8:37:57:1851 131 clone::AL662826.11:1:145431:1 1458 0 37M * 0 262 GTGAATTGGAGTCCTGNGTTTTATTTTCCTTTCCCAC AB?@BBBAB<@?AAB:!<<BBB@BBBB@;BBBB=ABA MF:i:18 Aq:i:0 NM:i:1 UQ:i:0 H0:i:0 H1:i:4
IL6_3125:8:58:1625:1479 147 clone::AL662826.11:1:145431:1 1471 0 37M * 0 -247 CTGAGTTTTATTTTCCTTTCCCACCTCAAACCCCACA @8???@<?:>@;<6@B:96BBB6BB>BAB;BBBB>BB MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
IL6_3125:8:37:57:1851 83 clone::AL662826.11:1:145431:1 1683 0 37M * 0 -262 GAAGGACTTACTGAGATGGCTGCTCCCACTCTCCAGC BBACA?=BB=;BCABB9BC7AC9BAAA>AB5@/?CC@ MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
IL6_3125:8:93:491:1573 67 clone::AL662826.11:1:145431:1 3983 0 37M * 0 221 CTGGAATACAGAGGTTTTCACGGAAGCCCAGGGGACC BCB?BBCCBBBBBBABCCBBC>>AB>ABA@;9>8>=B MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0
IL6_3125:8:93:491:1573 147 clone::AL662826.11:1:145431:1 4167 0 37M * 0 -221 CTCCCCCAGCCCAGGGGTCTGGCTTCCCCAGGAGGAC =;?>A?A>=9A@A?<5>?=@@AA?ABAAAA@BA@AAA MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:1
IL6_3125:8:81:1190:1139 131 clone::AL662826.11:1:145431:1 6556 0 37M * 0 238 CACAGTAGAGCTTGGAGCAGAGATGCTAGGCCCCTAT BCBBBBC@BCBCCBC@BCBCBB;ABBB@BBBBABBB@ MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
IL6_3125:8:81:1190:1139 83 clone::AL662826.11:1:145431:1 6757 0 37M * 0 -238 CCCAGAAGGAGCCAGGGCAGCACTTGGCAAGCTGCCC A99@AAAABBBABBABBAABBBB<BBA=BBABAB@@B MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
IL6_3125:8:90:135:1121 131 clone::AL662826.11:1:145431:1 8359 0 37M * 0 155 CCTGTGTGTGCACATGTGCACGTGTATGTGTATGTGT B>AAACBC>BBCBAA<7A=B55):?B@CBC26@B9=9 MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:4 H1:i:0
IL6_3125:8:90:135:1121 83 clone::AL662826.11:1:145431:1 8477 0 37M * 0 -155 ACTGACGTCTGCTGAAATCAAGCATGGCCCCTGCTGG ;=>>?BA>@@@>>@A>BBAAAAAAABCBA?@@BCCCB MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0
repinementer is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:39 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO