Hi All,
I found two reads with sam flag 4 (unmapped) but with MAPQ 23 and with actual map positions.
Maybe I'm missing something trivial here... I aligned reads (27 bp) using BWA, converted sam to bam and I sorted the bam. (Unfortunately, I deleted the sam and unsorted bam.)
Here's the incriminated reads:
Versions:
bwa 0.5.9-r16
samtools 0.1.15
How can it be?
Any comment/explanation welcome
Many thanks
Dario
I found two reads with sam flag 4 (unmapped) but with MAPQ 23 and with actual map positions.
Maybe I'm missing something trivial here... I aligned reads (27 bp) using BWA, converted sam to bam and I sorted the bam. (Unfortunately, I deleted the sam and unsorted bam.)
Here's the incriminated reads:
Code:
samtools view -f 4 -q 13 cage_12102010_lps.sorted.bam HWUSI-EAS1501_0026_FC707N4AAXX:1:56:6629:10136#0 4 MT 16589 23 27M * 0 0 GAAATTCTAACTAAATTATTCCCTGCA G:====;12;77647&4228<DDD8B; XT:A:U NM:i:1 X0:i:1 X1:i:1 XM:i:1 XO:i:0 XG:i:0 MD:Z:25G1 XA:Z:15,+119268672,27M,2; HWUSI-EAS1501_0026_FC707N4AAXX:1:94:8019:14641#0 4 MT 16589 23 27M * 0 0 GAAATTCTAACTAAATTATTCCCTGCA D0?BB?=DDD9C>?=);=A@==;3;;@ XT:A:U NM:i:1 X0:i:1 X1:i:1 XM:i:1 XO:i:0 XG:i:0 MD:Z:25G1 XA:Z:15,+119268672,27M,2;
bwa 0.5.9-r16
samtools 0.1.15
How can it be?
Any comment/explanation welcome
Many thanks
Dario
Comment