SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
comparison of Ion Proton RNAseq data with Illumina pair end data? vipul jain General 3 01-25-2015 11:11 AM
MiSeq FastQ Header for pair-end data golharam Illumina/Solexa 3 01-16-2015 02:06 PM
75+35 Pair-end SOLiD RNA-seq data analysis endether SOLiD 11 12-12-2012 04:40 PM
how to combine pair end data into one file forget1997 Bioinformatics 6 06-19-2011 01:45 PM
What is this strand specific pair-end RNA-seq data? xhuister Bioinformatics 2 09-14-2010 06:34 AM

Reply
 
Thread Tools
Old 10-07-2015, 02:36 PM   #1
bbm
Member
 
Location: North Carolina

Join Date: Sep 2011
Posts: 38
Default cutadapt questions on pair-end seqeuencing data

I'm trying to use cutadapt to trim my data. The adaptor sequences from Illumina only has a universal adapter, then one sequence for each index.
Example here:
TruSeq Universal Adapter
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1 5
5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2
5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3
5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG

When I read the guide from cutadapt for pair-end data, they suggest a file named ADAPTER_FWD (should be trimmed from the forward reads (filename.1.fastq.gz) and a file named ADAPTER_REV from the reverse reads (filename.2.fastq.gz).
So my question is: What sequence do I put in ADAPTER_FWD, and what sequence in ADAPTER_REV?


The command is:
cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq
bbm is offline   Reply With Quote
Old 10-07-2015, 02:58 PM   #2
bbm
Member
 
Location: North Carolina

Join Date: Sep 2011
Posts: 38
Default

Another related question here:
My sequencing center said they didn't trimmed any adapters. So I went to the fastq.gz files, and grep the adapter sequence for the first 1 million reads, I only have 10442 hits. I wonder why the hits number is so small? Does that mean 989,558 reads are shorter and without the adapters?
Thanks!
bbm is offline   Reply With Quote
Old 10-07-2015, 03:20 PM   #3
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

Most sequences will be shorter than full length, and/or contain errors, and thus not match exactly with grep.

I recommend you use BBDuk for adapter trimming, using the command at the top of the post.
Brian Bushnell is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:52 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO