Tweet
hello has anyone worked with MiRPara?
-
-
yes, let me know if you have any questions. -
This tool is not working online as i have taken many sequences from mirbase but it is not giving result only the example which is given on the site is giving result.Please can u help me out with this.Comment
-
Really?
I randomly selected one sequence from mirbase and it works.
>rno-mir-216a MI0000955
GUUAGCUAUGAGUUAGUUUAAUCUCAGCUGGCAACUGUGAGAUGUCCCUAUCAUUCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGACCUC
It is possible that the sequences you selected would result in no result, because
1) miRPara's accuracy is ~80%
2) not all miRNAs from miRBase is correct miRNAs.Comment
-
ok thanks.but have you used its standalone version?Comment
-
Yes, this is better, I can predict for whole viruses geneomes.Originally posted by Jayu View PostComment
-
Hi Itried to work with the standalone miRPara4.1 on linux fedoraOriginally posted by Jayu View Post
I follow the download instructions and when i run the code I got the following message
[root@localhost miRPara4.1]# perl miRPara.pl seq.fasta
Checking for UNAFold.p... found
Checking for ct2out... found
Use of uninitialized value $title in concatenation (.) or string at miRPara.pl line 272.
RNAFolding for _1_393...sh: /usr/local/bin/ct2out: No such file or directory
done
All Done.
Use of uninitialized value in null operation during global destruction.
also I have an output file with only the print statements without any classification results may u help meComment
-
Originally posted by eng_sheringokhy View Post
hi, have you installed ct2out? if yes, did you copy this file to the /usr/local/bin/?Comment
-
yes I did
I have the same resultComment
-
Do you mind sent the sequence to me? I can debug the miRPara and solve the problem for you.Comment
-
thank you so muchOriginally posted by weasteam View Post
may you send me your Email
>hsa-let-7a-1 MI0000060
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA
>hsa-let-7a-2 MI0000061
AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU
>hsa-let-7a-3 MI0000062
GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU
>hsa-let-7b MI0000063
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG
>hsa-let-7c MI0000064
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCLast edited by eng_sheringokhy; 06-08-2012, 10:54 AM.Comment
-
Sorry, I did not notice your reply. please download the most updated miRPara, miRPara4.2 at http://www.whiov.ac.cn/bioinformatics/mirpara or http://code.google.com/p/mirpara/downloads/list, it should fix the bug.Originally posted by eng_sheringokhy View PostComment
-
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...04-04-2024, 04:25 PM -
Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...03-22-2024, 06:39 AM
Comment