![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
Odd bwa-mem alignment | myronpeto | Bioinformatics | 16 | 03-12-2015 12:40 PM |
bwa mem -R option | dakin | Bioinformatics | 2 | 05-02-2013 08:42 AM |
BWA conflicting flags | ekageyama | Bioinformatics | 0 | 09-10-2012 04:47 AM |
velveth_de running time and mem | Ori | Bioinformatics | 10 | 11-03-2011 05:39 PM |
Sam flags for bwa-aligned paired end reads with identical + / - strand coordinates | spark | Bioinformatics | 0 | 03-09-2011 05:00 AM |
![]() |
|
Thread Tools |
![]() |
#1 |
Junior Member
Location: Chicago Join Date: May 2013
Posts: 2
|
![]()
Hey everyone,
I'm currently running bwa mem on some 454 single-end reads I have. My past experience with the bwa/samtools setup was with Illumina paired-end reads and using bwa aln/sampe (different projects). After looking at some of my first output for the bwa mem algorithm, I noticed there are no X0/X1 flags, which in the sampe output represent qualities such as number of best hits and number of suboptimal hits, respectively. Looking at the description of the bwa mem algorithm though on the bwa webpage (http://bio-bwa.sourceforge.net/bwa.shtml), it sounds like maybe the mem algorithm will only produce exact/unique matches, such that the X0/X1 flags are no longer needed (MEM -- maximal exact matches)? I'm interested in knowing this since I'd like to filter reads based on whether they have matches to multiple locations in the genome, and the X0/X1 tags were useful for doing this previously. Has anyone played around with bwa mem yet and/or can comment on whether they still got X0/X1 flags when using it? Thanks! Last edited by mturchin20; 05-20-2013 at 04:18 PM. |
![]() |
![]() |
![]() |
#2 |
Junior Member
Location: Chicago Join Date: May 2013
Posts: 2
|
![]()
So I've looked into this a little further and thought I'd just put up what I'm currently thinking in case anyone has something else to contribute.
It looks like while the bwa samse/sampe produces X0/X1 tags, the bwa mem/bwa bwasw do not produce such tags. Instead (and now just specifically referring to bwa mem), it looks like the XP tag is used to identify both 1) long reads that have split alignments and 2) reads that have multiple alignments overall. In the former situation (of a long read being split), both reads will have a XP tag. Using the -M flag will cause the shorter read of the two to be flagged as "the alignment is not primary" in the bitwise FLAG field (column 2). Not including the -M flag will leave both reads as appearing 'primary' (which I'm guessing is what causes the issues with Picard/GATK that the documentation mentions?). In the latter situation (of a read having multiple hits overall), you can see the other sequence hits using the -a flag. In these situations, the 'primary' read does not contain a XP tag but the sub-primary reads do. Given this situation, I still think it isn't straight forward to determine whether a read is 'uniquely mapped' or not. I've read about using the MAPQ value as a way to determine this, e.g. a MAPQ of 0 means the read is not uniquely mapped, but I feel like I see examples where the MAPQ is >0 and there are multiple alignments for that read. For example: HXBHIOF01CJXWW 0 10 69647562 22 23M1D5M2I39M * 0 0 AACCTCAGGTGATCCGTCCGCCTGGCCTGCCCCAAAGTGCTGGGCTTACAGGCATGTGCCACCTTGCCC EE???:5332=CCC==<=>B@@><;5557444244;??CCC;;;;AED???EFECED>==?;:766854 NM:i:5 AS:i:46 XS:i:36 HXBHIOF01CJXWW 256 X 94956752 0 23M1D5M2I33M6S * 0 0 * * NM:i:5 AS:i:36 XP:Z:10,+69647562,23M1D5M2I39M,22,5; HXBHIOF01CJXWW 272 19 16193041 0 39M2I5M1D23M * 0 0 * * NM:i:7 AS:i:36 XP:Z:10,+69647562,23M1D5M2I39M,22,5; HXBHIOF01CJXWW 256 3 169612909 0 23M1D5M2I39M * 0 0 * * NM:i:8 AS:i:35 XP:Z:10,+69647562,23M1D5M2I39M,22,5; HXBHIOF01CJXWW 256 12 122144914 0 22M1D6M2I26M13S * 0 0 * * NM:i:4 AS:i:34 XP:Z:10,+69647562,23M1D5M2I39M,22,5; The first read has a MAPQ of 22 even though it maps to other regions in the genome (all with MAPQ of 0, admittedly). Additionally this is not a long read that has been split (excluding the -a flag only produces the first read). So I guess my current thinking is that I should still use a MAPQ threshold (10 or 30?), but that this may not produce a full set of 'uniquely mapping' reads? |
![]() |
![]() |
![]() |
#3 |
Junior Member
Location: Detroit Join Date: Jun 2013
Posts: 1
|
![]()
Can you use the difference between the AS tag and the XS tag?
I can't see the XS tag in your output, it may come with the newest version. |
![]() |
![]() |
![]() |
#4 |
Senior Member
Location: Sydney Join Date: Feb 2011
Posts: 149
|
![]()
The "SA" tag is now used (v0.7.5) to identify reads which have chimeric alignment:
https://github.com/lh3/bwa/blob/master/NEWS |
![]() |
![]() |
![]() |
#5 |
Junior Member
Location: Denmark Join Date: Nov 2008
Posts: 1
|
![]()
A comment to how uniquely mapped reads can be extracted. As far as I understand a read is uniquely mapped when AS and XS tags differ - pls correct me if im wrong. Actually I have seen XS values being bigger than AS values which I dont really understand - Cant find a thorough description of what XS orhter than its the score for a suboptimal alignment.
ex with XS bigger than AS: HWUSI-EAS664L:24:64FGCAAXX:4:11:3337:6807 99 gi|407955691|dbj|AP012495.1| 1359455 0 101M = 1359704 351 CCAATGGCCGCTGCCAGTGGCGTTTTGTCGTGTCTTTCCGGGTTGGACTCAAGTTGATAGTTACCGGA TAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTC IIHGDIIIIGIIDIIIIEHIIIIGIIGHIIIIHHHIIIIIHIEIIIHIIIHGHIIIFGHIFIHHHIICIGHHHIIIBCGHGEGHGGDGHBEGGIGEFEAD? NM:i:8 MD:Z:3G4T13A1A0A10A16A0C46 AS:i:62 XS:i:68 So is this an example of a uniquely mapped read ? |
![]() |
![]() |
![]() |
#6 | |
Member
Location: Cologne,Germany Join Date: May 2012
Posts: 12
|
![]() Quote:
could you please elaborate, the provided link is broken. the main question is: are the reads with the SA: code still unique? what about the ones that also incorporate the XA: code? Here are some examples Code:
BIOMICS-HISEQHI:522:HCYM5ADXX:2:1102:3525:68438 256 chr2 161581931 0 32M17H * 0 0 TATCCATTTCATCTGGATTTTCTAGTTTATTT CAC<E?E<E????DDF@DBEB<D?9??D99D< NM:i:0 MD:Z:32 AS:i:32 XS:i:20 SA:Z:chr12,87311999,-,32M17S,0,0; BIOMICS-HISEQHI:522:HCYM5ADXX:2:1212:1519:12286 256 chr2 161581931 1 32M19H * 0 0 TATCCATTTCATCTGGATTTTCTAGTTTATTT .):639=>?>?8??<)7;7)=8=8)0>8>?.6 NM:i:0 MD:Z:32 AS:i:32 XS:i:27 SA:Z:chr12,87311997,-,34M17S,1,1; XA:Z:chr12,+46991828,32M19S,1; BIOMICS-HISEQHI:522:HCYM5ADXX:2:2115:10843:5627 256 chr2 161581931 1 32M19H * 0 0 TATCCATTTCATCTGGATTTTCTAGTTTATTT B?@AB@AABBBBABBB<ABBB?BAB?BB?BBB NM:i:0 MD:Z:32 AS:i:32 XS:i:27 SA:Z:chr12,87311997,-,34M17S,1,1; XA:Z:chr12,+46991828,32M19S,1; BIOMICS-HISEQHI:522:HCYM5ADXX:2:2115:14837:88360 256 chr2 161581931 1 32M19H * 0 0 TATCCATTTCATCTGGATTTTCTAGTTTATTT B?BBBBBBBB=ABBBBBBB?A?ABB0=A?BBB NM:i:0 MD:Z:32 AS:i:32 XS:i:27 SA:Z:chr12,87311997,-,34M17S,1,1; XA:Z:chr12,+46991828,32M19S,1; BIOMICS-HISEQHI:522:HCYM5ADXX:2:1209:6904:71888 0 chr11 22585338 0 18S33M * 0 0 TTTTCCCATTCTGTAGATTGTCTGTTTACTCTGATTATAGTTTATTTTGCT IGGIIIIIIIIGA@GGGHFIIIIIFFHEIHIHFGIHIIIIFEIGHEGHCHF NM:i:0 MD:Z:33 AS:i:33 XS:i:33 SA:Z:chr17,59076122,+,33M18S,0,0; XA:Z:chr3,+175713108,51M,4;chr2,-116989725,16S35M,1;chr19,+21698327,7S29M15S,0; BIOMICS-HISEQHI:522:HCYM5ADXX:2:1212:1519:12286 16 chr12 87311997 1 34M17S * 0 0 TCTATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA ??>?9@?=.:().))?>.)6.?>8>0)8=8=)7;7)<??8?>?>=936:). NM:i:1 MD:Z:0A33 AS:i:33 XS:i:31 SA:Z:chr2,161581931,+,32M19S,1,0; XA:Z:chr9,-104599379,51M,5;chr3,+170653467,51M,5; BIOMICS-HISEQHI:522:HCYM5ADXX:2:2115:10843:5627 16 chr12 87311997 1 34M17S * 0 0 TCTATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA BBBBBBABBABABABBBBBBBB?BB?BAB?BBBA<BBBABBBBAA@BA@?B NM:i:1 MD:Z:0A33 AS:i:33 XS:i:31 SA:Z:chr2,161581931,+,32M19S,1,0; XA:Z:chr9,-104599379,51M,5;chr3,+170653467,51M,5; BIOMICS-HISEQHI:522:HCYM5ADXX:2:2115:14837:88360 16 chr12 87311997 1 34M17S * 0 0 TCTATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA BBBBBBABB>A<B>B>A?7BBB?A=0BBA?A?BBBBBBBA=BBBBBBBB?B NM:i:1 MD:Z:0A33 AS:i:33 XS:i:31 SA:Z:chr2,161581931,+,32M19S,1,0; XA:Z:chr9,-104599379,51M,5;chr3,+170653467,51M,5; BIOMICS-HISEQHI:522:HCYM5ADXX:2:1102:3525:68438 16 chr12 87311999 0 32M17S * 0 0 TATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA AA==5.DB8BB8=/??*<D99D??9?D<BEBD@FDD????E<E?E<CAC NM:i:0 MD:Z:32 AS:i:32 XS:i:30 SA:Z:chr2,161581931,+,32M17S,0,0; XA:Z:chr9,-104599381,49M,4;chr3,+170653467,49M,4;chr12,+46991828,49M,5; BIOMICS-HISEQHI:522:HCYM5ADXX:2:1209:6904:71888 256 chr17 59076122 0 33M18H * 0 0 TTTTCCCATTCTGTAGATTGTCTGTTTACTCTG IGGIIIIIIIIGA@GGGHFIIIIIFFHEIHIHF NM:i:0 MD:Z:33 AS:i:33 XS:i:32 SA:Z:chr11,22585338,+,18S33M,0,0; XA:Z:chr4,-151801895,19S32M,0; |
|
![]() |
![]() |
![]() |
Tags |
bwa mem x0 x1 |
Thread Tools | |
|
|