SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
tophat + cufflinks: strand information Zimbobo Bioinformatics 29 04-20-2012 01:35 AM
Tophat~Error retrieving prep_reads info ruc9 Bioinformatics 6 02-28-2012 08:56 AM
Strand orientation after tophat mapping Inti RNA Sequencing 0 10-12-2011 04:11 AM
strand of the tophat output liuxq Bioinformatics 0 05-17-2011 06:27 AM
tophat junction strand ia_aka Bioinformatics 0 12-22-2010 11:28 PM

Reply
 
Thread Tools
Old 09-16-2010, 01:37 PM   #1
frankyue50
Member
 
Location: CA

Join Date: Nov 2008
Posts: 34
Default tophat strand info?

can anyone help me identify if the strand info is in the accepted.sam file (tophat output)
SOLEXA1_0001:1:60:7595:15462#0 16 chr1 3000555 255 36M * 0 0 AATTTGTTTTGTCCTTCAGCGGATTAAAATATTCAG CBBBCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC NM:i:0

or does anyone know what is column 2 and 4 means. I checked sam manual but still confused. Thanks.
frankyue50 is offline   Reply With Quote
Old 09-16-2010, 03:49 PM   #2
john_mu
Member
 
Location: Stanford, CA

Join Date: May 2010
Posts: 88
Default

Hi,

The strand info will only be on the junction reads. It is impossible to determine the strand of non-junction hits without using a stranded protocol in the experiment.

column 2 is the SAM flag. You can google "SAM flag" to find out.

column 4 is the chromosome start location of the hit.
__________________
SpliceMap: De novo detection of splice junctions from RNA-seq
Download SpliceMap Comment here
john_mu is offline   Reply With Quote
Old 04-01-2011, 12:51 AM   #3
smueller
Junior Member
 
Location: Jena

Join Date: Apr 2011
Posts: 1
Default

Hey,

I just came accross the same problem and found that you can read strand info from the
2nd colunmn. This is actually a flag that has to be deciphered according to the SAM format and can be done for instance here:
http://picard.sourceforge.net/explain-flags.html
In your case, 16 means that this read is on the reverse strand.
Column 4 is the start postition of this read on the respective chromosome.
Note, since tophat produce BAM formats as default for a while, you can still
access the flag information with:
samtools view accepted_hits.bam
which produces SAM format.

cheers
Sebastian
smueller is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:36 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO