SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Interpreting INDELs aforntacc Bioinformatics 7 02-24-2015 11:12 AM
varscan - filter out those snps close to indels david.tamborero Bioinformatics 4 11-19-2014 02:41 AM
Calling Indels IonTom Ion Torrent 2 05-03-2014 08:11 AM
DGE - filter or not filter masterpiece Bioinformatics 0 07-11-2011 09:55 PM
Filtering Indels isomer Illumina/Solexa 0 04-23-2010 05:53 AM

Reply
 
Thread Tools
Old 03-22-2018, 10:24 AM   #1
mitchum20
Junior Member
 
Location: Berlin

Join Date: Mar 2018
Posts: 3
Default Filter for indels

Dear all,

I am looking at sequence data from a fungal microorganism strain mapped to an assembled reference genome sequence:
Number of reads: 5.5 Mill Paired End
Platform : Illumina HiSeq 2000
Length read : 126 bp

I want to retrieve the number of insertions / deletions between different strains and I applied BCFtools to list indels found with reasonable coverage in CDS regions. However, the identified indels are too many and not convincing as they include repetitions. (e.g. GCAACAGCAGCAACAGCAACAGCAGCAACA/GCA)

Please also look at the attached IGV

Do you know a way to filter meaningful indels? Which criteria would you apply?

Best ; Tom
Attached Images
File Type: png indel.png (14.0 KB, 4 views)

Last edited by mitchum20; 03-22-2018 at 10:53 AM.
mitchum20 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:57 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO