Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • PubMed: Integrative analysis of the melanoma transcriptome.

    Syndicated from PubMed RSS Feeds

    Integrative analysis of the melanoma transcriptome.

    Genome Res. 2010 Feb 23;

    Authors: Berger MF, Levin JZ, Vijayendran K, Sivachenko A, Adiconis X, Maguire J, Johnson LA, Robinson J, Verhaak RG, Sougnez C, Onofrio RC, Ziaugra L, Cibulskis K, Laine E, Barretina J, Winckler W, Fisher DE, Getz G, Meyerson M, Jaffe DB, Gabriel SB, Lander ES, Dummer R, Gnirke A, Nusbaum C, Garraway LA

    Global studies of transcript structure and abundance in cancer cells enable the systematic discovery of aberrations that contribute to carcinogenesis, including gene fusions, alternative splice isoforms, and somatic mutations. We developed a systematic approach to characterize the spectrum of cancer-associated mRNA alterations through integration of transcriptomic and structural genomic data, and we applied this approach to generate new insights into melanoma biology. Using paired-end massively parallel sequencing of cDNA (RNA-seq) together with analyses of high-resolution chromosomal copy number data, we identified 11 novel melanoma gene fusions produced by underlying genomic rearrangements, as well as 12 novel readthrough transcripts. We mapped these chimeric transcripts to base-pair resolution and traced them to their genomic origins using matched chromosomal copy number information. We also used these data to discover and validate base-pair mutations that accumulated in these melanomas, revealing a surprisingly high rate of somatic mutation and lending support to the notion that point mutations constitute the major driver of melanoma progression. Taken together, these results may indicate new avenues for target discovery in melanoma, while also providing a template for large-scale transcriptome studies across many tumor types.

    PMID: 20179022 [PubMed - as supplied by publisher]



    More...

  • #2
    Anyone know how (they/you can) mapped to the reference "transcriptome" and then cross-mapped those alignments to the genome to capture exon-exon junctions? I really like this analysis concept. Seems simple enough to align a dataset to a transcriptome reference but then how to you assign these alignments to genome coordinates?

    Comment


    • #3
      BAM file flagstats

      I have never used RNA seq data -- so I decided to repeat some analysis from above paper:

      I download supplemental data from

      http://www.ncbi.nlm.nih.gov/sites/en...&term=GSE17593[Accession]&cmd=search

      NCBI's Gene Expression Omnibus (GEO) is a public archive and resource for gene expression data.


      Run samtools flagstat on bam file :

      I have hard time understanding the flagstats output

      For e.g.
      samtools flagstats GSM506401_MEWO.paired.bwa.remapped.bam > GSM506401_MEWO.paired.bwa.remapped.bam.flagstats

      GSM506401_MEWO.paired.bwa.remapped.bam.flagstats
      10361094 in total
      0 QC failure
      3784092 duplicates
      10361094 mapped (100.00%)
      10361094 paired in sequencing
      5180547 read1
      5180547 read2
      0 properly paired (0.00%)
      10361094 with itself and mate mapped
      0 singletons (0.00%)
      0 with mate mapped to a different chr
      0 with mate mapped to a different chr (mapQ>=5)

      Sample :
      SL-XAN_2_FC30BV1AAXX:1:47:1108:971 161 chrM 2 37 51M = 416 0 ATCACAGGTCTATCACCCTATTAACCACTC
      ACGGGAGCTCTCCATGCATTT 77777777777777777777777777777766644122122222222.222 XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0
      MD:Z:51
      SL-XAN_2_FC30BV1AAXX:1:17:1367:1052 97 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCA
      CGGGAGCTCTCCATGCATTTT 77777777777777777777777777777774+44-222222/2222222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0
      MD:Z:50G0
      SL-XAN_2_FC30BV1AAXX:1:48:1493:1675 161 chrM 3 37 51M = 396 0 TCACAGGGCTATCACCCTATTAACCACTCA
      CGGGAGCGCTCCATGCATTTG 66,66666666666666666(66666666$66'6+,2'22!)'2,22,222 XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0
      MD:Z:7T29T13
      SL-XAN_2_FC30BV1AAXX:1:2:1699:495 1121 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCA
      CGGGAGCTCTCCATGCATTTT 7753577770757777777777777-777-71+1'/22221/%2/2*222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0
      MD:Z:50G0
      SL-XAN_2_FC30BV1AAXX:1:94:521:1276 97 chrM 4 37 51M = 326 0 CACAGGTCTATCACCCTATTAACCACTCAC
      GGGAGCTCTCCATGCATTTGG 77777777777777777777777777777707777222222/2/2*222/% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0
      MD:Z:51



      a) I am assuming these are mapped bam files (From paper : "Alignments were performed using the Burrows-Wheeler Alignment Tool (BWA), allowing up to four mismatches with the reference")
      b) Please can somebody help me understand flagstats -- it is 100% mapped but there are "0 properly paired" reads
      c) Please also let me know if you have any suggestions for software package -- which can be used explore this data.

      Thanks
      Last edited by newbee; 04-20-2010, 03:01 PM.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Essential Discoveries and Tools in Epitranscriptomics
        by seqadmin




        The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
        04-22-2024, 07:01 AM
      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Today, 08:47 AM
      0 responses
      10 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      60 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      57 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      53 views
      0 likes
      Last Post seqadmin  
      Working...
      X