SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
adaptor, barcode, and tag morning latte Bioinformatics 9 07-12-2013 12:42 PM
Adaptor removal, trimming, vs masking ramirob Bioinformatics 3 03-27-2013 11:31 PM
Illumina1.8 Paired-End Barcode Splitting? pbatzel Bioinformatics 2 10-25-2011 03:08 PM
How to determine 454 paired end adaptor sequence edge 454 Pyrosequencing 10 10-01-2009 01:23 AM
Sample/Simulated data for testing adaptor trimming hydkat Illumina/Solexa 0 12-03-2008 02:09 AM

Reply
 
Thread Tools
Old 02-05-2014, 03:44 PM   #1
Iria
Junior Member
 
Location: Hawaii

Join Date: Dec 2010
Posts: 1
Unhappy adaptor/barcode trimming that are NOT in the 5' or 3' end

Hi,

Is there any tool available that allows to trim adapter (and primers) that are inside of the reads (not in the 5' or 3' ends)?

For whatever reason a portion of my reads have a variable number of random bases before the adapter and primer. I need a tool that is able to trim the adapter+primer and any bases before it (this is between the 5'end and the adapter). I need to do the same for the 3'ends, where I have the same issue.

This is an example of such a read. In red are the adapter and primer sequences. After trimming, only the lower case portion should remain:

>made-up example
ATCGTAGTATTAGGATCGTCGCTGATGACTGAatgatgatagttacctagagcta[...]cgacatcacgaccccgatagaATAGCTAGCTATCGATCGATCTGACATAGACA

A custom script would do it as well. I tried using the bash tool grep, but wasn't able to make it work.

These sequences are amplicons generated using barcoded COI primers in PacBIO (with the Conserved Consensus Sequencing protocol). When I say adapter I mean the barcode that was added to the primers to be able to split the libraries.

Thanks in advance for your answers.

Iria
Iria is offline   Reply With Quote
Old 02-05-2014, 11:06 PM   #2
dietmar13
Senior Member
 
Location: Vienna

Join Date: Mar 2010
Posts: 107
Default Agrep

agrep, a fuzzy grep version:
http://en.wikipedia.org/wiki/Agrep

best implemeted in TRE:
http://en.wikipedia.org/wiki/TRE_(computing)
dietmar13 is offline   Reply With Quote
Old 02-06-2014, 05:24 AM   #3
relipmoc
Member
 
Location: Los Angeles, CA

Join Date: Jul 2011
Posts: 58
Default Skewer

Suppose the content of test.fasta is:

>made-up example
ATCGTAGTATTAGGATCGTCGCTGATGACTGAatgatgatagttacctagagctaGAGACCGCCT
GGGAATACCGGGTGCTGTAGGCTTTGGAATTCcgacatcacgaccccgatagaATAGCTAGCTA
TCGATC
GATCTGACATAGACA

and you use the following command:
$ cat test.fasta | skewer -x ATAGCTAGCTATCGATC -e 3 - -1 2>/dev/null | skewer -x ATTAGGATCGTCGCTGATGACTGA -e 5 - -1 2>/dev/null

you will get the following result:

>made-up example
atgatgatagttacctagagctaGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTTTGGAATTCcgacatcacgaccccgataga

where ATAGCTAGCTATCGATC is the 3' end adapter sequence; ATTAGGATCGTCGCTGATGACTGA is the 5' end adapter sequence.

See http://seqanswers.com/forums/showthr...ghlight=skewer for more details.
relipmoc is offline   Reply With Quote
Reply

Tags
barcode, trim adapter

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:23 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO