SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Any suggestion for Chip-Seq analysis? kumtl Bioinformatics 1 04-01-2014 06:53 PM
Data Analysis Suggestion for a Newbie? krispy Bioinformatics 4 04-05-2013 07:21 PM
Need suggestion about RNA-seq shw Bioinformatics 0 12-12-2011 09:01 AM
ChIP-Seq: seqMINER: an integrated ChIP-seq data interpretation platform. Newsbot! Literature Watch 0 12-24-2010 04:53 AM
seqMINER: An integrated ChIP-seq data interpretation platform krebs Bioinformatics 2 08-16-2010 06:08 AM

Reply
 
Thread Tools
Old 10-27-2014, 04:13 PM   #1
arkilis
Senior Member
 
Location: Australia

Join Date: Jul 2013
Posts: 119
Default Any suggestion on how to get to know the seq data is from which platform?

Got some data from other lab people. They are not sure what platform it is. So I used the fastqc which can have a check on the read length and some tips on what platform it is. i.e. Quality scores across all bases (Sanger/ illumina 1.9 encoding). I would reckon it is probably from sanger.

Any other thoughts?

Thanks,
arkilis is offline   Reply With Quote
Old 10-27-2014, 04:50 PM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.
Brian Bushnell is offline   Reply With Quote
Old 10-27-2014, 06:25 PM   #3
arkilis
Senior Member
 
Location: Australia

Join Date: Jul 2013
Posts: 119
Default

Quote:
Originally Posted by Brian Bushnell View Post
Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.
Thanks for answering.

One example line here is :

@M00474:102:000000000-A9000:1:1101:19225:1361 1:N:0:1
TGCTCACCTCGCCGCTGCACTGTGAAGCTCTCACCAACCCCGTAGTTGTTTCTGCACACGGTGTCCACCTGGCCCCGCCTGTCCTCCAGGATGTCCTTCTGGCTGTTCCAGGACTCGGCGACAGGCCGCCCTAGCTCCGTCACCGCCCGGTACTCCCCCCCGTCGCTGTCGAAGCGCACGAACTCCTCCTGGTTATAGAAGAGTCTTTCCAGGAACTGCACCCGCTCCGTCCCGTTGAAGAAATGACACTT
+
CACCCGGGGGBFGCGGGGFGGFGGDEGGFGGGGGGECFGGGGGDCFGFF,CFGGGGGGGD@FCGGGFGGGC,EFGGGGGG@FGGGGGFFFFGGFGGGGGG9<FGCFGGGGGFGFGGECFFDFB:BFGEFGGGDCFFGG@EGGGGGGGGG7E@EFGFGGG*CEEG:CEEGGGF5EDDGDEEGDGGGFFFGGFCFFFFF6D*)9CFGFFGFGG9:?(8?FF7?FB>>9>BB??FFFBFF()6<2:AABA7?B9

Any idea? Thanks again!
arkilis is offline   Reply With Quote
Old 10-27-2014, 07:12 PM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.
Brian Bushnell is offline   Reply With Quote
Old 10-27-2014, 07:39 PM   #5
arkilis
Senior Member
 
Location: Australia

Join Date: Jul 2013
Posts: 119
Default

Quote:
Originally Posted by Brian Bushnell View Post
Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.
You are right. Mr. Genius! Just get confirmed with client. MiSeq.
arkilis is offline   Reply With Quote
Reply

Tags
data analysis

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:30 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO