SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
Finding and segregating low-complexity regions coding the genome Genomics101 Bioinformatics 0 12-19-2013 10:42 AM
best way to compute how many reads map to non-coding regions? PFS Bioinformatics 2 03-20-2011 01:56 PM
Samtools: SNP calling from only coding regions newbietonextgen Bioinformatics 5 12-10-2010 02:42 PM
RNA-seq reads mapping to coding regions m!x RNA Sequencing 0 02-17-2010 01:04 PM

Reply
 
Thread Tools
Old 09-24-2015, 04:06 AM   #1
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default coding regions

Hello,

how can I identify correct coding regions in a sequence--with the help of blast
kaps is offline   Reply With Quote
Old 09-24-2015, 04:48 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,811
Default

With one of the translated blast searches.

From http://www.ncbi.nlm.nih.gov/books/NBK1734/

Quote:
There are three varieties of translated BLAST search; “tblastn,” “blastx,” and “tblastx.” In the first variant, “tblastn,” a protein sequence query is compared to the six-frame translations of the sequences in a nucleotide database. In the second variant, “blastx,” a nucleotide sequence query is translated in six reading frames, and the resulting six-protein sequences are compared, in turn, to those in a protein sequence database. In the third variant, “tblastx,” both the “query” and database “subject” nucleotide sequences are translated in six reading frames, after which 36 (6 × 6) protein “blastp” comparisons are made. Protein sequences are better conserved than their corresponding nucleotide sequences. Because the translated searches make their comparisons at the level of protein sequences, they are more sensitive than direct nucleotide sequence searches. A common use of the “tblastn” and “blastx” programs is to help annotate coding regions on a nucleotide sequence; they are also useful in detecting frame-shifts in these coding regions. The “tblastx” program provides a sensitive way to compare transcripts to genomic sequences without the knowledge of any protein translation, however, it is very computationally intensive.
GenoMax is offline   Reply With Quote
Old 09-24-2015, 06:26 AM   #3
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default

Ok. so in annotation, how do I know whether my region is at 5' or 3' end? partial or complete?
kaps is offline   Reply With Quote
Old 09-24-2015, 06:58 AM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,811
Default

Co-ordinates of the blast "hit" should provide that information. Unless I am not understanding your question.
GenoMax is offline   Reply With Quote
Old 09-24-2015, 07:05 AM   #5
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default

In case like the one below, is the CDS both 5' and 3' partial or its only 5' partial? and what is the correct start position?

Range 1: 673 to 1681GenBankGraphics
Next Match
Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1857 bits(1005) 0.0 1008/1009(99%) 1/1009(0%) Plus/Minus

Query 12 AGTTCCCCCTTATCATTTTTCACATAAAATACTCGTTCCATCAGTCCACGTTCCAGGTTC 71
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1681 AGTTCCCCCTTATCATTTTTCACATAAAATACTCGTTCCATCAGTCCACGTTCCAGGTTC 1622

Query 72 ACCGCAGAGTTGTTGTGGACCCCAAATTCATACAGGTTGCCCAAACCTGCAATCCGGAAC 131
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1621 ACCGCAGAGTTGTTGTGGACCCCAAATTCATACAGGTTGCCCAAACCTGCAATCCGGAAC 1562

Query 132 ACTCTGCGGGTTTTGTGTCTCGTGTCTTTAAAGTGGCTACGGAGTTTGGGGTGCCGCGCA 191
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1561 ACTCTGCGGGTTTTGTGTCTCGTGTCTTTAAAGTGGCTACGGAGTTTGGGGTGCCGCGCA 1502

Query 192 CGTGTGCGCCGAGACTGCACCCCAAGCCACTCTTCAAGACACCCCTATTTCAGCTCCTGG 251
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1501 CGTGTGCGCCGAGACTGCACCCCAAGCCACTCTTCAAGACACCCCTATTTCAGCTCCTGG 1442

Query 252 AATAGGGCTGGGTCATCCAGCCCACCCAGGTGCCTAACCCAATTACGCCATGCTTTTCCG 311
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1441 AATAGGGCTGGGTCATCCAGCCCACCCAGGTGCCTAACCCAATTACGCCATGCTTTTCCG 1382

Query 312 CTCAGTGGGTTGTTGAATACTCGCCGTAGGGGTGTCTCCTCCACAAATTGTGCGCGATAT 371
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1381 CTCAGTGGGTTGTTGAATACTCGCCGTAGGGGTGTCTCCTCCACAAATTGTGCGCGATAT 1322

Query 372 TGGCGACAGATCTCAATGGATTCATCGCGCAGTGGAATTGAAGCTCTTCCAACATCAGTA 431
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1321 TGGCGACAGATCTCAATGGATTCATCGCGCAGTGGAATTGAAGCTCTTCCAACATCAGTA 1262

Query 432 CGGCACGGCATAAACACATATGGCAGGGCCATCGAAATGGCAGTACGGGAGTCAGTTGGA 491
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1261 CGGCACGGCATAAACACATATGGCAGGGCCATCGAAATGGCAGTACGGGAGTCAGTTGGA 1202

Query 492 TTCATATTTGCTTGCTCACACTTCCGTACCAGGAACCGCCAAACCGTGAGTTCGTTGGCA 551
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1201 TTCATATTTGCTTGCTCACACTTCCGTACCAGGAACCGCCAAACCGTGAGTTCGTTGGCA 1142

Query 552 GTGGTTTTCTTTGGAATCCCGCCGAATTCTAGTTTTGCGAGAGTCACTAGGTTTCTGACG 611
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1141 GTGGTTTTCTTTGGAATCCCGCCGAATTCTAGTTTTGCGAGAGTCACTAGGTTTCTGACG 1082

Query 612 GCAGGGCCAAACTCACGGATGAGAAATGTGGACTGCTCTTTTTGTGTCACTGTGCCTTCT 671
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1081 GCAGGGCCAAACTCACGGATGAGAAATGTGGACTGCTCTTTTTGTGTCACTGTGCCTTCT 1022

Query 672 TCGTCCACAATCTCTGGAACCAGAACGTGTTTAGTCAGACAGTCCTGAAGGGATAGAATA 731
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1021 TCGTCCACAATCTCTGGAACCAGAACGTGTTTAGTCAGACAGTCCTGAAGGGATAGAATA 962

Query 732 GGGGCCGTCGGACCATTGAGTTTCATAACC-TCATCGCTCCATTCTGTTCCATAGCCTGT 790
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct 961 GGGGCCGTCGGACCATTGAGTTTCATAACCATCATCGCTCCATTCTGTTCCATAGCCTGT 902

Query 791 TCCACCTGGGAGATTTGTGACTGTTCCCGAGTTGGGAGTTCCTGATCGGATTTTAGCTCC 850
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 901 TCCACCTGGGAGATTTGTGACTGTTCCCGAGTTGGGAGTTCCTGATCGGATTTTAGCTCC 842

Query 851 CACCTGTAGACATACTCTTTCAATGCCTTCCGGGCGAGGACACATGAAAAATATGCCCCC 910
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 841 CACCTGTAGACATACTCTTTCAATGCCTTCCGGGCGAGGACACATGAAAAATATGCCCCC 782

Query 911 GCGGCCAGCAGGGAGAAGCGAACTGCTAGCCGAACGTACCGTGACGTTTGTTGAATCACT 970
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 781 GCGGCCAGCAGGGAGAAGCGAACTGCTAGCCGAACGTACCGTGACGTTTGTTGAATCACT 722

Query 971 GAGCCCCCAGTCTGAGTCAACTTGTTTCGAGTAGACATCCACAGACCAT 1019
|||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 721 GAGCCCCCAGTCTGAGTCAACTTGTTTCGAGTAGACATCCACAGACCAT 673
kaps is offline   Reply With Quote
Old 09-24-2015, 07:14 AM   #6
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,811
Default

There is not enough context here as to what this alignment is about/from. If you are interested in "coding" regions you should be using a translated search for confirmation.
GenoMax is offline   Reply With Quote
Old 09-24-2015, 07:39 AM   #7
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default

in the above case, I have done a blastn so as to detect any hits (several are obtained) but showed only one. my aim in this is first to identify the orientation of the alignment, whether its partial or complete at 5' or 3' or both. Then after that identify reading frames using ORFfinder.
kaps is offline   Reply With Quote
Old 09-24-2015, 08:28 AM   #8
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,811
Default

Make a note of the co-ordinates in the blast result above. Your query is going from 12-1059 but the hit is actually showing co-ordinates that decrease from 1681-673. That is an indication that the "hit" in this case is on the opposite strand (also indicated by the Q/S = "Plus/Minus" in the header). Depending how how long your query was you can make a judgement of how complete the coverage on the hit is.
GenoMax is offline   Reply With Quote
Old 09-25-2015, 12:56 AM   #9
SylvainL
Senior Member
 
Location: Geneva

Join Date: Feb 2012
Posts: 175
Default

Hi,

I believe you would get faster and easier-to-read results if you directly go with blastx...

s.
SylvainL is offline   Reply With Quote
Reply

Tags
blast, coding, region

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:19 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO