
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
BWA mapping quality score is unstable mschatz Bioinformatics 0 09-15-2011 12:03 PM
Question about BWA mapping quality oiiio Bioinformatics 6 07-25-2011 05:33 PM
BWA mapping quality scores? kweber2 Genomic Resequencing 2 09-27-2010 04:01 PM
Interpretation of BWA mapping quality christophpale Bioinformatics 0 07-21-2010 04:15 AM
bwa mapping quality totalnew Bioinformatics 6 05-21-2010 05:50 AM

Thread Tools
Old 07-08-2011, 07:07 PM   #1
Junior Member
Location: San Francisco

Join Date: Jul 2011
Posts: 5
Default negative bwa mapping quality


Does anyone know what negative bwa mapping quality means?

I am using the aligned data from 1000 genome project (I look at this sample NA12716.mapped.ILLUMINA.bwa.CEU.low_coverage.20101123.bam). For a properly mapped pair reads, I found that the mapping quality for one read is 226 and the other is -226. Does anyone know why?

When I do pileup in samtools, it excludes that read with negative mapping quality.

Here is that pair reads data:

ERR000573.12285810 pPR2 X 154402571 60 51M = 154402756 226 GATGCAATAAGAGATAAAGCTAGAGAGGTTAATAGAGGCCAGAACTCATAG =@%?>:@@?@>=>=@?A@>>@3>:=<=>:A>@@>=1=>;>929?>$>4@2> X0:i:1 X1:i:0 MD:Z:51 RG:Z:ERR000573 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR000573.12285810 pPr1 X 154402756 60 9S42M = 154402571 -226 GCGAAGAAGTCAATTAGAAAGTCTTTTCAAGTTATCCAAGCAGGAGGTCTC 27=AA=8A;<?A?@>@>@@@=;>=<>>?A@>@>@:?>AA>?@>??>>=?9? X0:i:1 X1:i:0 XC:i:42 MD:Z:42 RG:Z:ERR000573 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@

Thank you very much!!

Anney is offline   Reply With Quote
Old 07-09-2011, 12:56 AM   #2
Location: united kingdom

Join Date: Feb 2010
Posts: 63

Interesting and confusing to me too.
Sam manual says that field five is the mapping quality; From manual;
field 5 = MAPQ Int [0,2^8-1] MAPping Quality

However and interestingly, the MQ:i: tag is apparently the mapping quality of the mate/next fragment, which for your alignment are both 60
MQ i = Mapping quality of the mate/next fragment

So I would also be interested to know where -226 comes from too and what exactly is MQ reporting if 226 and -226 are genuine.

Another point is, if I understand and can do the math right, Mapping quality -10 x log10(probability of an error). So you would need a probability of about 1x10^25???????

Last thing; I assume the sam output reports the genome sequence not the reads, as this maps uniquely, at 100% to human genome hg19 to a unique position. So it should have a fantastic mapping score?

An interested bystander.
poisson200 is offline   Reply With Quote
Old 07-11-2011, 11:45 AM   #3
Junior Member
Location: San Francisco

Join Date: Jul 2011
Posts: 5

Thank you for the replay poisson200.

I checked BWA on its website ( It says that it is possible one read in a pair has high mapping quality, but the other read has zero ("one read can be mapped unambiguously, but its mate falls in a tandom repeat and thus its accurate position cannot be determined"). So, I guess the negative mapping quality score means the undetermined mapping read. If so, then the flag shouldn't be "pPR2", which mean properly mapped pair-reads !?

And, samtools excludes the reads with negative mapping score (in default filter) when doing pileup.

Anney is offline   Reply With Quote
Old 07-11-2011, 12:20 PM   #4
Location: Cambridge

Join Date: Feb 2009
Posts: 22

I believe you are looking at the template length field (field 9). The mapping quality is the 5th field and is reported to be 60 for both reads.
jts is offline   Reply With Quote
Old 07-11-2011, 02:42 PM   #5
Junior Member
Location: San Francisco

Join Date: Jul 2011
Posts: 5

oh...yeah....thanks for pointing this out
Anney is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 08:41 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO