SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq v3 Reagents with v2 flowcell esherman Illumina/Solexa 2 12-08-2014 04:04 AM
Bubbles in Miseq Flowcell DRYTCYV Illumina/Solexa 3 07-18-2014 05:07 PM
Free app. for sample tracking and sample sheet generation aubreeh Illumina/Solexa 0 10-15-2013 01:00 PM
.csv sample sheet for Caporaso protocol -16s Amplicon Sequencing chiaraf Sample Prep / Library Generation 0 02-26-2013 01:25 AM
sample sheet? babilei 454 Pyrosequencing 1 01-05-2011 05:42 AM

Reply
 
Thread Tools
Old 02-13-2015, 03:41 PM   #1
harijay
Junior Member
 
Location: Cambridge, MA

Join Date: Feb 2015
Posts: 4
Default Miseq: ERROR: FlowCell ID is inconsistent across Sample Sheet lines.

Hi all,
I want to run bcl2fastq on my MiSeq runs . After reading previous posts , I got the program built and running with perl v5.14.4 on an Ubuntu 14.04 machine.

My test Samplesheet conforms to a Casava style sheet and is reproduced below. However , when I run the command line also listed below , I get the following error message

"ERROR: FlowCell ID is inconsistent across Sample Sheet lines. Expected: 'Casava:emultiplex::SampleSheet::Csv=HASH(0x2a87de8)->flowCellId()', got Date
at /home/hari/bcl2fastq/lib/bcl2fastq-1.8.4/perl/Casava/Demultiplex.pm line 531"

I want to use the bcl2fastq to get all my reads into one large "undetermined" *.fastq.gz file for test demultiplexing using my self written python tool for learning purposes and was wondering how to get around the error in running the program.

Thanks in advance

The detailed Sample sheet with "dummy" barcodes is :

[Header],,,,,,,,,
IEMFileVersion,4,,,,,,,,
Date,1/12/2015,,,,,,,,
Workflow,GenerateFASTQ,,,,,,,,
Application,FASTQ Only,,,,,,,,
Assay,TruSeq Amplicon,,,,,,,,
Description,,,,,,,,,
Chemistry,Amplicon,,,,,,,,
,,,,,,,,,
[Reads],,,,,,,,,
325,,,,,,,,,
275,,,,,,,,,
,,,,,,,,,
[Settings],,,,,,,,,
ReverseComplement,0,,,,,,,,
,,,,,,,,,
[Data],,,,,,,,,
FCID,Lane,Sample_ID,SampleRef,index,Description,Control,Recipe,Operator
000000000-ABHN2,1,SampleA,no_ref,AAAAAAAA-TTTTTTTT,NA,N,NA,NA,
000000000-ABHN2,1,SamplB,no_ref,AAAAAAAA-TATTTTTT,NA,N,NA,NA,
000000000-ABHN2,1,SamplC,no_ref,AAAAAAAA-ATTTTTTT,NA,N,NA,NA,



The commandline I am using is :
~/bcl2fastq/bin/configureBclToFastq.pl --input-dir /home/hari/141218_M02528_0004_000000000-ABHN2/Data/Intensities/BaseCalls --output-dir /home/hari/runbcl2fasta/ --force --sample-sheet /home/hari/runbcl2fasta/SampleSheet.csv --no-eamss


The error I get in detail is :
Use of qw(...) as parentheses is deprecated at /home/hari/bcl2fastq/lib/bcl2fastq-1.8.4/perl/Casava/Alignment/Config.pm line 747.
Use of qw(...) as parentheses is deprecated at /home/hari/bcl2fastq/lib/bcl2fastq-1.8.4/perl/Casava/Alignment/Config.pm line 751.
[2015-02-13 19:39:00] [configureBclToFastq.pl] INFO: Basecalling software: RTA
[2015-02-13 19:39:00] [configureBclToFastq.pl] INFO: version: 1.18 (build 54)
[2015-02-13 19:39:00] [configureBclToFastq.pl] INFO: Original use-bases mask: undefined
[2015-02-13 19:39:00] [configureBclToFastq.pl] INFO: Guessed use-bases mask: yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy,IIIIIIIn,IIIIIIIn,yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy
ERROR: FlowCell ID is inconsistent across Sample Sheet lines. Expected: 'Casava:emultiplex::SampleSheet::Csv=HASH(0x2a87de8)->flowCellId()', got Date
at /home/hari/bcl2fastq/lib/bcl2fastq-1.8.4/perl/Casava/Demultiplex.pm line 531

A typical read from this looks like:

@M02528:3:000000000-ABHN2:1:1111:7446:8241 1:N:0:0
AAGGGCTCGCTAACTTGTCTAAGATCATACAAAAAGAATTGAATCCAGATCTTCTTAATGCTCTGGCAGCACTCTAAAATCATCTTGGCCTTTAAAAAAAACGTGGCTGAAACCTACCCCAAACTCAATTAAATTCCAATCTCTGAGGGTTGAGATGGGCATTAGTATTTTTTATAATTGGGCCAAGTGATTATAGTGTGCAGCTGAAGTTGAGAACCATGGCTCTGACTAAAGAGGCAGTGCCACTCCTACTACTTTCCACAAGAAGGGACGGGGCATTTTTTGAACGAGTGTGCATTCTAAATACTCTTGGAACACTTTCAGA
+
CCCCCGGGGCFGEGFGGFFFGGFGGGGGGGFFGGGGFFGGGGGFFFFGGFEFGFGGGGGGGFGGFGGGGGGGGGGGGG<FFAFGGFEG8FGGGEFEGGGGGGGGGGGFGGGGGGGG8<BFGGGGGGGGGGGGEDGCGFECFGGGGCFFGGGFGGCBFGGGGFGFGGFGAEGGGGGGGGGGGGGFBDDGGGGGGGCCFFFFGGGGGGCFEGGGFFGG79FDGG5CCFGFFDGG:FGGFGGGGFGGGGGFGGGGFGFFFCC8C?FFFGGGGB<5>EF@BFFF47AB9:A???9?FB>FA2<FAD<9><<B2<A<04<228>46<>>)
harijay is offline   Reply With Quote
Old 02-13-2015, 04:12 PM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,975
Default

Try using a simple samplesheet like the example I have here: http://seqanswers.com/forums/showpos...4&postcount=14
GenoMax is offline   Reply With Quote
Reply

Tags
bcl2fastq, fcid, miseq, perl

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:56 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO