SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
create scaffold file from contig file and agp file? Wallysb01 Bioinformatics 2 05-10-2016 01:53 AM
Extract reference and aligned sequences from BAM file basing on VCF file floem7 Bioinformatics 3 01-19-2015 03:08 AM
How to make .bam file to .bai file format under MS Window7 operating system? Min Jung Lee Bioinformatics 6 11-21-2014 12:06 PM
Updated How to convert .txt file to .bed .GFF or .BAR file format, forevermark4 Bioinformatics 2 06-30-2014 05:02 AM
what is the file size for a 30X human genome sequencing file, raw and BAM? RNA-seq Illumina/Solexa 2 04-15-2011 11:27 AM

Reply
 
Thread Tools
Old 03-11-2015, 09:25 AM   #1
efoss
Member
 
Location: Seattle

Join Date: Jul 2011
Posts: 98
Default What is a kart file?

In trying to download files from SRA, I was directed to use part of the sratoolkit called "prefetch". There I came across the term "kart file":

http://www.ncbi.nlm.nih.gov/Traces/s...doc&f=prefetch

What is a kart file?

Thanks.

Eric
efoss is offline   Reply With Quote
Old 03-11-2015, 09:37 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,972
Default

If you have SRA accession numbers (and all you are interested in is downloading fastq data) then use this procedure: http://seqanswers.com/forums/showpos...36&postcount=7
GenoMax is offline   Reply With Quote
Old 03-11-2015, 12:45 PM   #3
efoss
Member
 
Location: Seattle

Join Date: Jul 2011
Posts: 98
Default

Hi GenoMax,

Thanks very much for the suggestion. I followed the instructions and they seemed to work in that the little snippet of test code worked as it should:

Code:
efoss@gizmod31:~/source_codes/sratoolkit.2.4.5-2-ubuntu64/bin$ ./fastq-dump -X 5 -Z SRR390728
Read 5 spots for SRR390728
Written 5 spots for SRR390728
@SRR390728.1 1 length=72
CATTCTTCACGTAGTTCTCGAGCCTTGGTTTTCAGCGATGGAGAATGACTTTGACAAGCTGAGAGAAGNTNC
+SRR390728.1 1 length=72
;;;;;;;;;;;;;;;;;;;;;;;;;;;9;;665142;;;;;;;;;;;;;;;;;;;;;;;;;;;;;96&&&&(
@SRR390728.2 2 length=72
AAGTAGGTCTCGTCTGTGTTTTCTACGAGCTTGTGTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGT
+SRR390728.2 2 length=72
;;;;;;;;;;;;;;;;;4;;;;3;393.1+4&&5&&;;;;;;;;;;;;;;;;;;;;;<9;<;;;;;464262
@SRR390728.3 3 length=72
CCAGCCTGGCCAACAGAGTGTTACCCCGTTTTTACTTATTTATTATTATTATTTTGAGACAGAGCATTGGTC
+SRR390728.3 3 length=72
-;;;8;;;;;;;,*;;';-4,44;,:&,1,4'./&19;;;;;;669;;99;;;;;-;3;2;0;+;7442&2/
@SRR390728.4 4 length=72
ATAAAATCAGGGGTGTTGGAGATGGGATGCCTATTTCTGCACACCTTGGCCTCCCAAATTGCTGGGATTACA
+SRR390728.4 4 length=72
1;;;;;;,;;4;3;38;8%&,,;)*;1;;,)/%4+,;1;;);;;;;;;4;(;1;;;;24;;;;41-444//0
@SRR390728.5 5 length=72
TTAAGAAATTTTTGCTCAAACCATGCCCTAAAGGGTTCTGTAATAAATAGGGCTGGGAAAACTGGCAAGCCA
+SRR390728.5 5 length=72
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;9445552;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;446662
However, when I went to try to download something real, it didn't work:

Code:
efoss@gizmod31:~/source_codes/sratoolkit.2.4.5-2-ubuntu64/bin$ ./fastq-dump -B SRA044886
2015-03-11T19:34:36 fastq-dump.2.4.5 err: item not found while constructing within virtual database module - the path 'SRA044886' cannot be opened as database or table
efoss@gizmod31:~/source_codes/sratoolkit.2.4.5-2-ubuntu64/bin$
This was an attempt to download fastq files that had been acquired with SOLiD, but I wanted them to download in base space. Does anyone have a suggestion to fix this? I Googled the error and found a suggestion to restore defaults with "vdv-config --restore-defaults":

https://github.com/ncbi/sra-tools/issues/7

but this didn't help.

Thanks.

Eric
efoss is offline   Reply With Quote
Old 03-11-2015, 01:43 PM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,972
Default

You need to use abi-dump for SOLiD data.

That said the accession number you posted above is not working with abi-dump. It is not uncommon to find accession numbers that do not work. Emailing sra-techsupport can be useful in these cases.

You can also find this dataset at ENA: http://www.ebi.ac.uk/ena/data/view/SRA044886 The files say they are "fastq" but you will need to check what format they are in.
GenoMax is offline   Reply With Quote
Old 03-11-2015, 01:46 PM   #5
efoss
Member
 
Location: Seattle

Join Date: Jul 2011
Posts: 98
Default

Hi Genomax,

Thanks very much. I really appreciate the help.

Eric
efoss is offline   Reply With Quote
Old 03-22-2016, 12:46 PM   #6
patinfotech
Junior Member
 
Location: Miami

Join Date: Mar 2016
Posts: 1
Default efoss asked 'What is a kart file? '

efoss asked 'What is a kart file? '

Does anyone have the answer and can you explain the format of the file and what information it contains?
patinfotech is offline   Reply With Quote
Old 03-22-2016, 02:26 PM   #7
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,972
Default

Cart (.kart) files are referenced in this document http://www.ncbi.nlm.nih.gov/books/NB...efetch_command I don't see a description of the file format.
GenoMax is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:45 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO