SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Primer design software for NGS amplicon sequencing of genes timforshew General 11 12-08-2018 12:20 AM
MiSeq Custom Sequencing Primer Tm? pmiguel Illumina/Solexa 43 11-12-2015 11:52 AM
experimental design for exome sequencing with the new MiSeq evakoe Sample Prep / Library Generation 0 02-13-2013 04:55 AM
Primer design for unidirectional sequencing soleulloa 454 Pyrosequencing 12 10-03-2011 04:52 AM

Reply
 
Thread Tools
Old 08-08-2013, 11:03 AM   #1
windhorse8
Member
 
Location: New York

Join Date: May 2011
Posts: 18
Default Primer and adapter design for small RNA sequencing in HiSeq2000 and MiSeq

Hi,
I need to sequence pools of small RNA (each pool with varying size ranging from 20-100 bases, so planning to use barcode for each pool) using Hiseq2000 or MiSeq. I don't have in-house access for NGS instruments. I need to design the primers with barcodes that are compatible in Hiseq2000 or Miseq. I will be sending the final PCR products for sequencing. I looked into different websites including Illumina for the adapter and primer sequences to design the primer sequences but couldn't find one.
Can anyone help me with information about the needed sequences? It will be single end, multiplexed, using single lane. I don't need deep coverage. 10000 reads/pool is sufficient.
My design template of possible final PCR product is as follow. Please let me know if I am on right track ?
3'GTTCGTCTTCTGCCGTATGCT-----NNNNNCTAGCAGCCTGACATCTTGAGACTTGG
ACAGCCACCAGCGGCATAGTAA'5
where ---- my RNA insert sequences ( only one strand is shown here).
NNNNN - barcode.
Thanks in advance.
windhorse8 is offline   Reply With Quote
Old 10-08-2013, 12:20 PM   #2
anusrinivasan
Junior Member
 
Location: San Francisco

Join Date: Feb 2011
Posts: 1
Default Illumina Truseq adapter sequences

If you speak to an Illumina sequencing customer service person and request a pdf with the adapter sequences, they will send it to you. In the past they have sent the pdf to anyone who requested it.
anusrinivasan is offline   Reply With Quote
Old 10-08-2013, 12:23 PM   #3
winsettz
Member
 
Location: US

Join Date: Sep 2012
Posts: 91
Default

http://support.illumina.com/download...es_letter.ilmn
winsettz is offline   Reply With Quote
Old 10-09-2013, 06:39 AM   #4
Genohub
Registered Vendor
 
Location: genohub.com

Join Date: Mar 2013
Posts: 210
Default

It sounds like you're trying to make your own libraries (not using a kit) ? Most kits will include the adapters you need. We have a description of some Small RNA Seq kits in our library prep guide.

How many samples do you plan on pooling? It sounds like you can afford to multiplex several samples. I would recommend a 36 or 50 cycle SE run. Using our shop by project, here are a few examples of 36 or 50 SE run services you could order.

- Genohub
Genohub is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:51 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO