SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
tophat/Cufflinks workflow question hmortens Bioinformatics 2 01-09-2012 10:26 AM
a question about tophat and cufflinks camelbbs Bioinformatics 0 06-27-2011 09:21 AM
Question to combine Bowtie output with Tophat's -- impact on Cufflinks FPKM values berath Bioinformatics 0 04-21-2011 08:38 AM
Differential expression analysis workflow in Cufflinks anna_vt Bioinformatics 4 12-19-2010 02:04 AM
Tophat/Cufflinks newbie - question about transcript assembly internet_nobody Bioinformatics 4 08-19-2010 09:03 AM

Reply
 
Thread Tools
Old 12-08-2009, 07:50 AM   #1
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default Tophat/cufflinks workflow question

If I have 6 samples, call them 1,2,3,4,5,6 (they could be 6 lanes or a 6 way multiplexed experiement). Then I want to compare 1,2,3 vs 4,5,6.

So if I map the reads using tophat, I assume I can run all the 1,2,3,4,5,6 in parallel and then cat and sort the relavant sam files together before I run cufflinks.

So

cat tophat1 tophat2 tophat3 | sort > 123.sam
cat tophat4 tophat5 tophat6 | sort > 456.sam

Then if I run cufflinks on 123.sam and 456.sam I get 123.transcripts.gtf and 456.transcripts.gtf.

So I was wondering what is the next step? Can I do

cuffcompare 123.transcripts.gtf -r geneannotations.gtf
cuffcompare 456.transcripts.gtf -r geneannotations.gtf

(geneannotations.gtf is an Ensembl annotations file)

so I get

123.transcripts.tmap and 456.transcripts.tmap

then I just compare the two data sets RPKM values using Ensembl ID as the in the same way you would use probe_id in a traditional array experiement?

Do I need to do any further normalization?

Am I missing something!?

Thanks in advance!
staylor is offline   Reply With Quote
Old 12-08-2009, 08:08 AM   #2
Cole Trapnell
Senior Member
 
Location: Boston, MA

Join Date: Nov 2008
Posts: 212
Default

Quote:

Then if I run cufflinks on 123.sam and 456.sam I get 123.transcripts.gtf and 456.transcripts.gtf.

So I was wondering what is the next step? Can I do

cuffcompare 123.transcripts.gtf -r geneannotations.gtf
cuffcompare 456.transcripts.gtf -r geneannotations.gtf

(geneannotations.gtf is an Ensembl annotations file)

You probably want:
cuffcompare -r geneannotations.gtf 123.transcripts.gtf

Looking then at the out.tracking file will then tell you how the Ensembl transcripts (along with whatever new transcripts you find) compare to each other in the two samples.


Quote:
Do I need to do any further normalization?


That's a tougher question. RPKM is a measure of relative gene expression designed to allow comparisons between experiments, just as you are asking to do. There are a fair number of people working on ways of correcting and normalizing for various biases in RNA-Seq, but there are no widely accepted means of doing so that I am aware of.
Cole Trapnell is offline   Reply With Quote
Old 12-08-2009, 09:08 AM   #3
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default

Quote:
Originally Posted by Cole Trapnell View Post
You probably want:
cuffcompare -r geneannotations.gtf 123.transcripts.gtf

Looking then at the out.tracking file will then tell you how the Ensembl transcripts (along with whatever new transcripts you find) compare to each other in the two samples.
Do you mean I need to do

cuffcompare -r geneannotations.gtf 123.transcripts.gtf 456.transcripts.gtf

otherwise how will the tracking file know about the two samples?

Quote:
That's a tougher question. RPKM is a measure of relative gene expression designed to allow comparisons between experiments, just as you are asking to do. There are a fair number of people working on ways of correcting and normalizing for various biases in RNA-Seq, but there are no widely accepted means of doing so that I am aware of.
Ok. Thanks for your help on this.
staylor is offline   Reply With Quote
Old 12-08-2009, 09:13 AM   #4
Cole Trapnell
Senior Member
 
Location: Boston, MA

Join Date: Nov 2008
Posts: 212
Default

Quote:
Do you mean I need to do

cuffcompare -r geneannotations.gtf 123.transcripts.gtf 456.transcripts.gtf

otherwise how will the tracking file know about the two samples?
Yes, sorry. That's what I get for responding before coffee.
Cole Trapnell is offline   Reply With Quote
Old 12-08-2009, 09:17 AM   #5
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default

:-) No problem.

Thanks for your help.
staylor is offline   Reply With Quote
Old 12-08-2009, 11:22 AM   #6
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default

I did

cuffcompare -r geneannotations.gtf 123.transcripts.gtf 456.transcripts.gtf

and got:

- - q1:CUFF.49|CUFF.49.0|100|320.741503|0.000000|0.000000|uniq -
- - q1:CUFF.922|CUFF.922.0|100|2080.321131|0.211081|0.210872|uniq -
- - q1:CUFF.2093|CUFF.2093.0|100|320.213468|0.000000|0.000000|uniq -
- - q1:CUFF.923|CUFF.923.1|100|2498.467902|0.159820|0.159979|uniq -
- - q1:CUFF.2964|CUFF.2964.0|100|136.004645|0.000000|0.000000|uniq -
- - q1:CUFF.3939|CUFF.3939.0|100|2146.036538|0.000000|0.000000|uniq -
- - q1:CUFF.4125|CUFF.4125.0|100|612.020902|0.000000|0.000000|uniq -
- - q1:CUFF.4410|CUFF.4410.0|100|4534.343539|0.000000|0.000000|uniq -
- - q1:CUFF.5384|CUFF.5384.0|100|1515.019712|0.000000|0.000000|uniq -
- - q1:CUFF.5667|CUFF.5667.0|100|1515.969648|0.000000|0.000000|uniq -
- - q1:CUFF.5952|CUFF.5952.0|100|5568.492065|0.000000|0.000000|uniq -
- - q1:CUFF.6333|CUFF.6333.0|100|2299.714905|0.000000|0.000000|uniq -
- - - q2:CUFF.611|CUFF.611.0|100|2209.360572|0.000000|0.000000|uniq
- - q1:CUFF.7536|CUFF.7536.0|100|702.690665|0.000000|0.000000|uniq -
- - q1:CUFF.7629|CUFF.7629.0|100|3756.201011|0.000000|0.000000|uniq -
- - q1:CUFF.9212|CUFF.9212.0|100|417.816071|0.000000|0.000000|uniq -
- - q1:CUFF.9554|CUFF.9554.0|100|9625.347396|0.000000|0.000000|uniq -
- - q1:CUFF.9797|CUFF.9797.0|100|2347.966478|0.000000|0.000000|uniq -
- - q1:CUFF.9965|CUFF.9965.0|100|702.690665|0.000000|0.000000|uniq -
- - q1:CUFF.8952|CUFF.8952.0|100|719.829462|0.000000|0.000000|uniq -
- - q1:CUFF.10691|CUFF.10691.0|100|1806.918854|0.000000|0.000000|uniq -
- - q1:CUFF.10799|CUFF.10799.1|100|3619.236510|0.284840|0.284870|uniq -
- - q1:CUFF.10839|CUFF.10839.0|100|2153.582326|0.000000|0.000000|uniq -
- - q1:CUFF.11538|CUFF.11538.0|100|7683.301808|0.000000|0.000000|uniq -
- - q1:CUFF.10782|CUFF.10782.0|100|89.705191|0.000000|0.000000|uniq -
- - q1:CUFF.10800|CUFF.10800.0|100|3902.596250|0.174811|0.174792|uniq -
- - q1:CUFF.10825|CUFF.10825.0|100|6510.429805|0.000000|0.000000|uniq -
- - q1:CUFF.12645|CUFF.12645.0|100|58.557555|0.000000|0.000000|uniq -
- - q1:CUFF.13320|CUFF.13320.0|100|1702.673535|0.000000|0.000000|uniq -
- - q1:CUFF.12088|CUFF.12088.0|100|6322.264673|0.000000|0.000000|uniq -
- - q1:CUFF.13147|CUFF.13147.0|100|8946.451886|0.000000|0.000000|uniq -
- - q1:CUFF.14256|CUFF.14256.0|100|782.998170|0.000000|0.000000|uniq -
- - q1:CUFF.14910|CUFF.14910.0|100|1953.822826|0.000000|0.000000|uniq -
- - - q2:CUFF.1367|CUFF.1367.0|100|2051.549103|0.000000|0.000000|uniq
- - q1:CUFF.15282|CUFF.15282.0|100|1686.457597|0.000000|0.000000|uniq -
- - q1:CUFF.15535|CUFF.15535.0|100|2326.148410|0.000000|0.000000|uniq -
- - q1:CUFF.16741|CUFF.16741.0|100|1297.275075|0.000000|0.000000|uniq -
- - q1:CUFF.17421|CUFF.17421.0|100|3055.953562|0.000000|0.000000|uniq -
- - q1:CUFF.17710|CUFF.17710.0|100|2845.146363|0.000000|0.000000|uniq -
- - q1:CUFF.19743|CUFF.19743.0|100|133.631524|0.000000|0.000000|uniq -
- - q1:CUFF.19375|CUFF.19375.0|100|2369.916793|0.000000|0.000000|uniq -
- - q1:CUFF.19582|CUFF.19582.0|100|4355.505260|0.000000|0.000000|uniq -
- - q1:CUFF.19789|CUFF.19789.0|100|5320.372181|0.000000|0.000000|uniq -
- - q1:CUFF.22524|CUFF.22524.0|100|647.153215|0.000000|0.000000|uniq -
- - q1:CUFF.22483|CUFF.22483.0|100|21957.950620|0.000000|0.000000|uniq -
- - q1:CUFF.22641|CUFF.22641.0|100|13234.040114|0.000000|0.000000|uniq -

Does this mean there are no overlaps for annotated genes? This sample was mutiplexed on 1 lane so there aren't as many reads as you would normally expect. Would this have something to do with it?
staylor is offline   Reply With Quote
Old 12-08-2009, 01:26 PM   #7
townway
Member
 
Location: Rockville

Join Date: May 2009
Posts: 40
Default

In cufflinks document, cufflinks only accepted input SAM format by “sort –k 3,3 –k 4,4n *.sam”. but when I use the *sam format generated by BWA, and type sort command, the format change from

NCI-GA2:1:1:4:358#0 147 chr1 53372939 60 35M = 53372816 -158 ATGGGCTGGAT
GATCCCTGTTCAGGCCTAATCCGC A>BAA>=BBBBBB@>?BBBA@8>BB>BBABB>BCB XT:A:U NM:i:0 SM:i:37 AM:i:23 X0:i:1 X1:
i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:35
NCI-GA2:1:1:4:1683#0 99 chrUn_gl000220 159630 0 35M = 159744 149 CTAGGGCGCGGGCCCGGGT
GGAGCCGCCGCAGGTG BB@A=?B<B?:>BBBAA<9BABABBBBB<BA=78A XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:2 X1:i:0 XM:
i:0 XO:i:0 XG:i:0 MD:Z:35

to

NCI-GA2:1:100:1000:1645#0 133 * 0 0 * * 0 0 TCCTCCTTTTTCACTTGAT
CCCACCGATGTCTGCC BCBCCCBBCCCBCB@BACABBCCCA>BAAABABBB
NCI-GA2:1:100:1000:1645#0 69 * 0 0 * * 0 0 CAAGTCTGCATGGCTGTTG
ACATAGGCAGACATCG BCCB=ABBABB@@AA@;>;A75/86=376;:;/9:
NCI-GA2:1:100:1000:391#0 133 * 0 0 * * 0 0 TACCGCGGCTGCTGGCACC
AGACTTGCCCAGATCG BAAAAABBAB>5>7998;<1=9:A@@>A@=>;=7=


Some part of the line are missing, so cufflinks would not recognize it. How can I change the sort parameter to get correct format for cufflinks?
townway is offline   Reply With Quote
Old 12-08-2009, 02:08 PM   #8
staylor
Member
 
Location: Oxford

Join Date: Feb 2009
Posts: 17
Default

Try filtering for hits only (simple way is grep for chr if your genome uses this in the fasta header line) and then sort.
staylor is offline   Reply With Quote
Reply

Tags
cuffcompare, cufflinks, tophat

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:58 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO