SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Best way to trim MiSeq - NEBNext Multiplex Oligos for Illumina Library foolishbrat Illumina/Solexa 1 01-27-2014 03:10 AM
Do not use "adapter trimming" in MiSeq Reporter 2.0.25 ECO Illumina/Solexa 9 12-10-2013 04:38 AM
Adapter trimming and trimming by quality question alisrpp Bioinformatics 5 04-08-2013 04:55 PM
Basic adapter trimming question - MiSeq microgirl123 Illumina/Solexa 2 09-18-2012 09:15 AM
NEBNext 454 rapid library TonyBrooks Sample Prep / Library Generation 1 08-01-2011 12:56 PM

Reply
 
Thread Tools
Old 01-26-2014, 09:45 PM   #1
foolishbrat
Member
 
Location: South East Asia

Join Date: Nov 2008
Posts: 44
Default Adapter trimming NEBNext Library / MiSeq

I have a 51 single-end reads generated with MiSeq using NEBNext Multiplex Oligos for Illumina.

The sample sheet looks like this:

Code:
IEMFileVersion,4
Investigator Name,FB
Experiment Name,WT10104
Date,11/27/2013
Workflow,GenerateFASTQ
Application,FASTQ Only
Assay,TruSeq Small RNA
Description,
Chemistry,Default

[Reads]
51

[Settings]
ReverseComplement,0

[Data]
Sample_ID,Sample_Name,Sample_Plate,Sample_Well,I7_Index_ID,index,Sample_Project,Description
HS130333-1,,,,RPI3,TTAGGC,,
HS130333-2,,,,RPI4,TGACCA,,
HS130333-3,,,,RPI5,ACAGTG,,
The Primer index manual can be found here.

Sor for HS130333-1 file, according to the manual above the primer/adapter with index is:
5 ́-CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3 ́

The document indicated that the expected index primer sequence read is TTAGGC which is the reverse complement of GCCTAA.


My question is if I use `trim_galore` or `cutadapt` to trim the data, what is the parameter -a I should use?

Is it the whole sequence above? Or first 5 ́-CAAGCAGAAGACGGCATACGAGAT?
Or GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3 ́? (and what is 's' means here)

Or the reverse complement of the each of above?
foolishbrat is offline   Reply With Quote
Old 01-27-2014, 12:06 AM   #2
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 619
Default

Since your sequence ends in ... GATC-s-T, you need to use its reverse complement, thus starting with AGATC.. This means you should be able to run Trim Galore in its default mode without specifying any -a because it is using just that sequence anyway.
fkrueger is offline   Reply With Quote
Old 01-27-2014, 12:21 AM   #3
foolishbrat
Member
 
Location: South East Asia

Join Date: Nov 2008
Posts: 44
Default

Hi, Thanks.

But the reverse complement of

5 ́-CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3 ́

Is this:
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG

I.e. it doesn't start with "AGATC".
Or trim_galore default adapter AGATCGGAAGAGC is no substring of the reverse complement above.

Did I miss anything?

Truly need your advice.
foolishbrat is offline   Reply With Quote
Old 01-27-2014, 12:24 AM   #4
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 619
Default

You need to add an A to the start of the reverse complemented sequence which is a result of the A-tailing process in the Illumina library preparation protocol. Then the start of both sequence will match up perfectly which is what your want to use. Hth
fkrueger is offline   Reply With Quote
Old 01-27-2014, 12:32 AM   #5
foolishbrat
Member
 
Location: South East Asia

Join Date: Nov 2008
Posts: 44
Default

Thanks a million!
So in the trimming process, I don't have to care about the index sequence "GCCTAA" or it's reverse complement "TTAGGC". Am I right?
foolishbrat is offline   Reply With Quote
Old 01-27-2014, 12:36 AM   #6
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 619
Default

That's right, the index is only relevant to sort out different barcodes; for adapter trimming purposes it is sufficient to specify only the start of the adapter which all indexed adapters have in common. Good luck!

Last edited by fkrueger; 01-27-2014 at 12:37 AM. Reason: sounds better
fkrueger is offline   Reply With Quote
Old 01-27-2014, 12:45 AM   #7
foolishbrat
Member
 
Location: South East Asia

Join Date: Nov 2008
Posts: 44
Default

Quote:
Originally Posted by fkrueger View Post
Since your sequence ends in ... GATC-s-T, you need to use its reverse complement, thus starting with AGATC.. This means you should be able to run Trim Galore in its default mode without specifying any -a because it is using just that sequence anyway.


You save my life. If you don't mind one last question.
How can I know whether or not to use the reverse complement adapter for trimming?

Any other alternative than GATC-s-T ending?
foolishbrat is offline   Reply With Quote
Old 01-27-2014, 12:50 AM   #8
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 619
Default

I think that all Illumina adapters end in exactly this sequence, you just need to draw it out once and it will become very obvious (I am certain a sketch of this can be found in of the other threads here on SeqAnswers). Small RNA adapter are different, but for all TruSeq adapters etc you should be fine using the defaults.
fkrueger is offline   Reply With Quote
Old 01-27-2014, 01:06 AM   #9
foolishbrat
Member
 
Location: South East Asia

Join Date: Nov 2008
Posts: 44
Default

Thank you.
foolishbrat is offline   Reply With Quote
Reply

Tags
trim adapter

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:39 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO