SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimmomatic: Not trimming.. lchippy Bioinformatics 6 11-13-2017 04:38 AM
Trimmomatic quality trimming kga1978 Bioinformatics 26 11-24-2015 10:14 AM
Trimmomatic but no trimming Saeideh Bioinformatics 6 09-28-2015 11:40 PM
Adapters trimming: Cutadapt vs Trimmomatic MafaldaSF Bioinformatics 8 03-20-2014 06:16 AM
Trimming Illumina PE sequences with Trimmomatic nicole_01 Bioinformatics 5 08-28-2013 05:12 PM

Reply
 
Thread Tools
Old 12-11-2018, 08:21 AM   #1
Tsequencing
Junior Member
 
Location: Europe

Join Date: Dec 2018
Posts: 4
Default Trimming seq data using Trimmomatic confirmation

Dear all,

I received my HiSeq Illumina RNAseq data and want to run trimmomatic to remove bad quality reads and trim adapters. I have used trimmomatic before but I am currently in doubt if I create the adapter file in a correct way, can someone please correct me if I'm wrong?

Sequencing happened on Illumina HiSeq4000 using NEBnext kit for the library construction.

From the sequencing facility I have received the adapter and index sequences (e.g for my first sample):

Adapter:
5' Adapter: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
3' Adapter(lowercase 6bp bases is Index) 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG-3

index:
CTGGCATA;CGGCTATG

- I do not understand why I receive two indexes for a single sample? A single sample, needs only one adapter with one specific index? Correct?

- Trimmomatic needs an adapter file and I will create as follows (with all adapters and indeces in a single file):

>Prefix_AdapterPE1/1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Prefix_AdapterPE1/2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACctggcataATCTCGTATGCCGTCTTCTGCTTG

With the index in capitals also, but just to show that I will manually add the index sequence. I will do this for all received index sequences, added to a single adapter file and will finally run Trimmomatic.

Any comments are welcome!
Tsequencing is offline   Reply With Quote
Reply

Tags
illumina, rnaseq, trimming reads, trimmomatic

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:09 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO