SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Split read extraction fanx Bioinformatics 4 10-23-2012 08:53 PM
Split read mapping bosTau2 Bioinformatics 13 04-30-2011 01:59 PM
PubMed: Anatomy of a hash-based long read sequence mapping algorithm for next generat Newsbot! Literature Watch 0 04-08-2011 02:10 AM

Reply
 
Thread Tools
Old 10-21-2021, 10:15 PM   #1
Pol2021
Junior Member
 
Location: germany

Join Date: Sep 2021
Posts: 2
Default Split read based on conserved sequence repeat

I have reads that contain repeats of 10 nt (conserved sequence is known). I want to split the reads into subunits, using the 10 nt as "marker" to know where to split.

As example (conserved sequence is cccgggttta):
>
acagtacccgggtttaatcgatcgatcgtacccgggtttagtacgtacgatcgtcccgggtttatgctgtcgtc

To get:
>
acagtacccgggttta
>
atcgatcgatcgtacccgggttta

>
gtacgtacgatcgtcccgggttta

>
tgctgtcgtc

Help is appreciated, thank you

Last edited by Pol2021; 10-21-2021 at 10:33 PM.
Pol2021 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:11 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO