SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Cufflinks / Cuffdiff problem Morten Bioinformatics 42 07-13-2013 11:51 PM
cufflinks running problem camelbbs Bioinformatics 6 07-14-2011 02:11 AM
Problem with Cufflinks output admiral RNA Sequencing 0 06-01-2011 02:19 PM
cufflinks question/problem jetspeeder Bioinformatics 0 06-24-2010 07:04 AM
Problem with Tophat and Cufflinks gongchang RNA Sequencing 2 06-08-2010 05:16 PM

Reply
 
Thread Tools
Old 05-23-2012, 09:52 AM   #1
RNAddict
Member
 
Location: East Coast

Join Date: Mar 2012
Posts: 17
Default Cufflinks problem sorting

I have mapped reads to a reference using tophat/bowtie. I then use the output from tophat with cufflinks... and I get the following error "sort order of reads in BAMs must be the same."

I have tried sorting my tophat output with samtools... but that still doesn't work.

I am confused because I am only using 1 BAM file... so I do not understand what it is comparing my BAM file to that it thinks the sort orders are different.

Anyone know about this? I have seen the error posted in different threads but those are dealing with cuffmerge or cuffdiff which would be joining or comparing multiple BAM files.
RNAddict is offline   Reply With Quote
Old 05-23-2012, 10:57 AM   #2
vyellapa
Member
 
Location: phoenix

Join Date: Oct 2011
Posts: 59
Default

Use picards ReorderSam.jar if you believe sort order is the issue.
vyellapa is offline   Reply With Quote
Old 05-23-2012, 10:57 AM   #3
RNAddict
Member
 
Location: East Coast

Join Date: Mar 2012
Posts: 17
Default

Below is an example from my accepted_hits.bam file I am trying to run with cufflinks

Code:
HWI-1KL118:19:C099JACXX:8:2303:8200:82055	99	comp10000_c1_seq1	29	3	48M1D52M	=	88	159	ATCTTACCCTGTCCCCACTCTCTAAGAAGAAGAGCTATTTTTCTATGCTGCAAAATATTTCAATATTAATCAGGAAAAAAACAGGAACAGAACAAAAACA	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:1	NH:i:2	CC:Z:comp9978_c0_seq1	CP:i:1751	HI:i:0
HWI-1KL118:19:C099JACXX:8:1104:11427:111619	419	comp10000_c1_seq1	31	3	100M	=	64	133	CTTACCCTGTCCCCACTCTCTAAGAAGAAGAGCTATTTTTCTATGCTTGCAAAATATTTCAATATTAATCAGGAAAAAAACAGGAACAGAACAAAAACAA	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:0	NH:i:2	CC:Z:comp9978_c0_seq1	CP:i:1750	HI:i:0
HWI-1KL118:19:C099JACXX:8:2204:11486:188570	99	comp10000_c1_seq1	31	3	100M	=	64	133	CTTNCCCTGTCCCCACTCTCTAAGAAGAAGAGCTATTTTTCTATGCTTGCAAAATATTTCAATATTAATCAGGAAAAAAACAGGAACAGAACAAAAACAA	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:1	NH:i:2	CC:Z:comp9978_c0_seq1	CP:i:1750	HI:i:0
HWI-1KL118:19:C099JACXX:8:2308:14574:10360	419	comp10000_c1_seq1	36	3	100M	=	104	168	CCTGTCCCCACTCTCTAAGAAGAAGAGCTATTTTTCTATGCTTGCAAAATATTTCAATATTAATCAGGAAAAAAACAGGAACAGAACAAAAACAAAACAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:0	NH:i:2	CC:Z:comp9978_c0_seq1	CP:i:1745	HI:i:0
HWI-1KL118:19:C099JACXX:8:2105:2435:109977	355	comp10000_c1_seq1	43	3	100M	=	52	109	CCACTCTCTAAGAAGAAGAGCTATTTTTCTATGCTTGCAAAATATTTCAATATTAATCAGGAAAAAAACAGGAACAGAACAAAAACAAAACACAATAGAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:0	NH:i:2	CC:Z:comp9978_c0_seq1	CP:i:1738	HI:i:0
HWI-1KL118:19:C099JACXX:8:2302:5607:56272	137	comp10000_c1_seq1	43	3	100M	*	0	0	CCACTCTCTAAGAAGAAGAGCTATTTTTCTATGCTTGCAAAATATTTCAATATTAATCAGGAAAAAAACAGGAACAGAACAAAAACAAAACACAATAGAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:0	NH:i:2	CC:Z:comp9978_c0_seq1	CP:i:1738	HI:i:0
HWI-1KL118:19:C099JACXX:8:2307:6056:194919	99	comp10000_c1_seq1	43	3	100M	=	64	121	CCACTCTCTAAGAAGAAGAGCTATTTTTCTATGCTTGCAAAATATTTCAATATTAATCAGGAAAAAAACAGGAACAGAACAAAAACAAAACACAATAGAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:0	NH:i:2	CC:Z:comp9978_c0_seq1	CP:i:1738	HI:i:0
Does anyone know if there are multiple reference sequences with the exact same name if that would cause this error?

EDIT: I found the problem... it was that I had multiple reference sequences with the same name. Removing the duplicates got rid of the error.

Last edited by RNAddict; 05-24-2012 at 05:41 AM.
RNAddict is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:45 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO