SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
Galaxy Bowtie alignment stats report ericguo Bioinformatics 1 12-08-2011 12:57 PM
Bowtie alignment report kevleb Bioinformatics 1 05-04-2011 01:54 AM
sequence alignment report slny Bioinformatics 3 03-17-2011 08:45 AM
perfect alignment match NicoBxl Bioinformatics 3 10-07-2010 05:28 AM
Redundant(?) report problem in tophat .sam file? Gangcai Bioinformatics 2 03-16-2010 01:05 AM

Reply
 
Thread Tools
Old 07-23-2012, 08:07 AM   #1
finfin
Junior Member
 
Location: Dallas

Join Date: Dec 2011
Posts: 8
Default SAM alignment result: match without reference report

Hi,

I used novoalign to map some sequence and got this kind of result in SAM format:

SRR2002 0 * 175710298 0 23M13H * 0 0 CAATTGTCAGAGGTGAAATTCTT B>7<?99@:9<=:;569=>B@=@ PG:Z:novoalign AS:i:55 UQ:i:55 NM:i:2 MD:Z:15G0C6

It is mapped to the genome, with the match start, strand, even the mismatches are reported. However, the third column, where should be "chrN" turned out to be a star.

Any one encountered this situation? Could any body kindly tell me why this happened?

Thanks in advance!
finfin is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:08 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO