Removing primers, adaptors, how to know if it's good? - Page 2

GenoMax · 05-08-2013, 12:46 PM

Quote:

Originally Posted by SS Santos

Or is there a file I can download with TruSeq adapters and barcodes?)

Sandra

You will find the sequences in this thread: http://seqanswers.com/forums/showthr...p?t=198&page=6 Post#113

SS Santos · 05-09-2013, 07:22 AM

Hi

GenoMax: you are right, I do have the barcode sequence in the first line of each read as you show in red, I just didn't know that it means it's not included in the read itself. If that's true it's good news.

Maria: I used grep -c to look for the 1st adapter and then for the reverse complement of the second one. Should I have looked for the complement of the 1st adapter instead?

I need the reads with the same length for one of the assemblers I'm testing, it doesn't run otherwise.

Snorberg: I'm sorry, but how do I determine the mean insert size?

zshuhua · 05-09-2013, 08:44 AM

Hi,
So, all the barcodes are NOT included in the read sequences but only in their IDs. We only need to trim adapters but not barcodes.

GenoMax · 05-09-2013, 09:47 AM

Quote:

Originally Posted by zshuhua

Hi,
So, all the barcodes are NOT included in the read sequences but only in their IDs. We only need to trim adapters but not barcodes.

If you used illumina's barcodes then the answer is yes. Please verify that your sequence provider has done the demultiplexing for you (as they should).

If you used custom barcodes that are "in-line" with the sequence read then you will need to do the demultiplexing yourself.

Illumina barcodes (1D or 2D) are read as a separate read(s) and are not part of the actual sequence.

GenoMax · 05-09-2013, 09:50 AM

Quote:

Originally Posted by SS Santos

Hi

GenoMax: you are right, I do have the barcode sequence in the first line of each read as you show in red, I just didn't know that it means it's not included in the read itself. If that's true it's good news.

That is correct. See my response to "zshuhua" above.

arcolombo698 · 12-12-2013, 06:00 PM

Quote:

Originally Posted by SS Santos

So they sent me this:

Adapters sequence:
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

sample barcode sequence
IST4113 TAGCTT
IST4129 AGTTCC
IST4134 CTTGTA
IST439 AGTCAA

Do I create a text file with this, how can use it as in input for trimming/filtering tools?

Thanks

Did you solve this issue ?? I have the same issue... do you create it as fasta format or as a txt file???

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
TruSeq Adaptors reported by FastQC are true adaptors?	Jiafen	Bioinformatics	3	11-07-2012 02:07 PM
PCR primers+adaptors	gio5	Sample Prep / Library Generation	2	01-05-2012 10:32 AM
Illumina Pair end primers and adaptors for multiplexing	mimi_lupton	Sample Prep / Library Generation	1	05-25-2011 08:57 AM
Removing primers	Khanjan	454 Pyrosequencing	1	02-05-2010 12:09 PM
primers and adaptors	xgm-1999	454 Pyrosequencing	2	09-22-2009 01:24 AM

05-09-2013, 07:22 AM	#22
SS Santos Member Location: Lisbon Join Date: Dec 2012 Posts: 12	Hi GenoMax: you are right, I do have the barcode sequence in the first line of each read as you show in red, I just didn't know that it means it's not included in the read itself. If that's true it's good news. Maria: I used grep -c to look for the 1st adapter and then for the reverse complement of the second one. Should I have looked for the complement of the 1st adapter instead? I need the reads with the same length for one of the assemblers I'm testing, it doesn't run otherwise. Snorberg: I'm sorry, but how do I determine the mean insert size?

05-09-2013, 08:44 AM	#23
zshuhua Junior Member Location: Ontario Join Date: May 2010 Posts: 4	Hi, So, all the barcodes are NOT included in the read sequences but only in their IDs. We only need to trim adapters but not barcodes.