SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
TruSeq Adaptors reported by FastQC are true adaptors? Jiafen Bioinformatics 3 11-07-2012 02:07 PM
PCR primers+adaptors gio5 Sample Prep / Library Generation 2 01-05-2012 10:32 AM
Illumina Pair end primers and adaptors for multiplexing mimi_lupton Sample Prep / Library Generation 1 05-25-2011 08:57 AM
Removing primers Khanjan 454 Pyrosequencing 1 02-05-2010 12:09 PM
primers and adaptors xgm-1999 454 Pyrosequencing 2 09-22-2009 01:24 AM

Reply
 
Thread Tools
Old 05-08-2013, 12:46 PM   #21
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,080
Default

Quote:
Originally Posted by SS Santos View Post
Or is there a file I can download with TruSeq adapters and barcodes?)


Sandra
You will find the sequences in this thread: http://seqanswers.com/forums/showthr...p?t=198&page=6 Post#113
GenoMax is offline   Reply With Quote
Old 05-09-2013, 07:22 AM   #22
SS Santos
Member
 
Location: Lisbon

Join Date: Dec 2012
Posts: 12
Default

Hi

GenoMax: you are right, I do have the barcode sequence in the first line of each read as you show in red, I just didn't know that it means it's not included in the read itself. If that's true it's good news.

Maria: I used grep -c to look for the 1st adapter and then for the reverse complement of the second one. Should I have looked for the complement of the 1st adapter instead?

I need the reads with the same length for one of the assemblers I'm testing, it doesn't run otherwise.

Snorberg: I'm sorry, but how do I determine the mean insert size?
SS Santos is offline   Reply With Quote
Old 05-09-2013, 08:44 AM   #23
zshuhua
Junior Member
 
Location: Ontario

Join Date: May 2010
Posts: 4
Default

Hi,
So, all the barcodes are NOT included in the read sequences but only in their IDs. We only need to trim adapters but not barcodes.
zshuhua is offline   Reply With Quote
Old 05-09-2013, 09:47 AM   #24
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,080
Default

Quote:
Originally Posted by zshuhua View Post
Hi,
So, all the barcodes are NOT included in the read sequences but only in their IDs. We only need to trim adapters but not barcodes.
If you used illumina's barcodes then the answer is yes. Please verify that your sequence provider has done the demultiplexing for you (as they should).

If you used custom barcodes that are "in-line" with the sequence read then you will need to do the demultiplexing yourself.

Illumina barcodes (1D or 2D) are read as a separate read(s) and are not part of the actual sequence.

Last edited by GenoMax; 05-09-2013 at 09:51 AM.
GenoMax is offline   Reply With Quote
Old 05-09-2013, 09:50 AM   #25
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,080
Default

Quote:
Originally Posted by SS Santos View Post
Hi

GenoMax: you are right, I do have the barcode sequence in the first line of each read as you show in red, I just didn't know that it means it's not included in the read itself. If that's true it's good news.
That is correct. See my response to "zshuhua" above.
GenoMax is offline   Reply With Quote
Old 12-12-2013, 06:00 PM   #26
arcolombo698
Senior Member
 
Location: Los Angeles

Join Date: Nov 2013
Posts: 142
Default Adapter ILLUMINA CLIP file format

Quote:
Originally Posted by SS Santos View Post
So they sent me this:

Adapters sequence:
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

sample barcode sequence
IST4113 TAGCTT
IST4129 AGTTCC
IST4134 CTTGTA
IST439 AGTCAA

Do I create a text file with this, how can use it as in input for trimming/filtering tools?

Thanks

Did you solve this issue ?? I have the same issue... do you create it as fasta format or as a txt file???
arcolombo698 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:51 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO