SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
Did I make directional or non-directional BS-seq libraries? shawpa Sample Prep / Library Generation 8 11-22-2017 04:44 AM
Werid RNA traces- bump above 28S - can I make libraries from this? Noa Sample Prep / Library Generation 1 11-08-2013 01:37 PM
using NEB kit to make libraries for Illumina MiSeq mkalive73 Illumina/Solexa 3 10-01-2013 11:13 AM
Which cloumn to take from SV Detect to make bed format to make it running on BEdtools vishal.rossi Bioinformatics 1 05-16-2013 04:59 AM
Make Clean and Make all not working qnc Bioinformatics 27 10-21-2011 11:17 AM

Reply
 
Thread Tools
Old 09-12-2014, 05:46 AM   #1
cazzy
Junior Member
 
Location: Cambridge

Join Date: Sep 2014
Posts: 2
Default Make your own libraries/barcodes?

Hello,

I am new to sequencing, and plan to perform genome-wide CRISPR/Cas9 screening as described in this paper - http://www.ncbi.nlm.nih.gov/pubmed/24336571

Here, they made their own amplicons by doing 1st PCR to amplify gRNA, then 2nd PCR to attach illumina adaptors and barcodes, without using a kit.

I wish to do the same, but don't know how to design my own barcodes? And what sequence do I use for the 1-9bp variable region?


F2

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(1-9bp variable length sequence) tcttgtggaaaggacgaaacaccg

R2 CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(8bp barcode)tctactattctttcccctgcactgt

Capitals are illumina adaptors, small letters are annealing regions.

Any suggestions are welcome.
cazzy is offline   Reply With Quote
Old 09-12-2014, 06:07 AM   #2
Baseless
Member
 
Location: Germany

Join Date: Feb 2010
Posts: 32
Default

Maybe this document from ILMN helps (page 23, the index part)?

http://supportres.illumina.com/docum...15044223-b.pdf

Last edited by Baseless; 09-12-2014 at 06:55 AM.
Baseless is offline   Reply With Quote
Old 09-12-2014, 06:50 AM   #3
cazzy
Junior Member
 
Location: Cambridge

Join Date: Sep 2014
Posts: 2
Default

Thanks Baseless, but which document are you referring to?
cazzy is offline   Reply With Quote
Old 09-12-2014, 06:57 AM   #4
Baseless
Member
 
Location: Germany

Join Date: Feb 2010
Posts: 32
Default

This is like writing an email and forgetting to actually put the attachment in place...sorry for the unconvenience, I edited the first response.
Baseless is offline   Reply With Quote
Reply

Tags
barcode, cas9, crispr, grna, libraries

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:57 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO