Make your own libraries/barcodes?

cazzy · 09-12-2014, 05:46 AM

Hello,

I am new to sequencing, and plan to perform genome-wide CRISPR/Cas9 screening as described in this paper - http://www.ncbi.nlm.nih.gov/pubmed/24336571

Here, they made their own amplicons by doing 1st PCR to amplify gRNA, then 2nd PCR to attach illumina adaptors and barcodes, without using a kit.

I wish to do the same, but don't know how to design my own barcodes? And what sequence do I use for the 1-9bp variable region?

F2

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(1-9bp variable length sequence) tcttgtggaaaggacgaaacaccg

R2 CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(8bp barcode)tctactattctttcccctgcactgt

Capitals are illumina adaptors, small letters are annealing regions.

Any suggestions are welcome.

Baseless · 09-12-2014, 06:07 AM

Maybe this document from ILMN helps (page 23, the index part)?

http://supportres.illumina.com/docum...15044223-b.pdf

cazzy · 09-12-2014, 06:50 AM

Thanks Baseless, but which document are you referring to?

Baseless · 09-12-2014, 06:57 AM

This is like writing an email and forgetting to actually put the attachment in place...sorry for the unconvenience, I edited the first response.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Did I make directional or non-directional BS-seq libraries?	shawpa	Sample Prep / Library Generation	8	11-22-2017 04:44 AM
Werid RNA traces- bump above 28S - can I make libraries from this?	Noa	Sample Prep / Library Generation	1	11-08-2013 01:37 PM
using NEB kit to make libraries for Illumina MiSeq	mkalive73	Illumina/Solexa	3	10-01-2013 11:13 AM
Which cloumn to take from SV Detect to make bed format to make it running on BEdtools	vishal.rossi	Bioinformatics	1	05-16-2013 04:59 AM
Make Clean and Make all not working	qnc	Bioinformatics	27	10-21-2011 11:17 AM

09-12-2014, 05:46 AM	#1
cazzy Junior Member Location: Cambridge Join Date: Sep 2014 Posts: 2	Make your own libraries/barcodes? Hello, I am new to sequencing, and plan to perform genome-wide CRISPR/Cas9 screening as described in this paper - http://www.ncbi.nlm.nih.gov/pubmed/24336571 Here, they made their own amplicons by doing 1st PCR to amplify gRNA, then 2nd PCR to attach illumina adaptors and barcodes, without using a kit. I wish to do the same, but don't know how to design my own barcodes? And what sequence do I use for the 1-9bp variable region? F2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(1-9bp variable length sequence) tcttgtggaaaggacgaaacaccg R2 CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(8bp barcode)tctactattctttcccctgcactgt Capitals are illumina adaptors, small letters are annealing regions. Any suggestions are welcome.

09-12-2014, 06:07 AM	#2
Baseless Member Location: Germany Join Date: Feb 2010 Posts: 32	Maybe this document from ILMN helps (page 23, the index part)? http://supportres.illumina.com/docum...15044223-b.pdf Last edited by Baseless; 09-12-2014 at 06:55 AM.

09-12-2014, 06:50 AM	#3
cazzy Junior Member Location: Cambridge Join Date: Sep 2014 Posts: 2	Thanks Baseless, but which document are you referring to?

09-12-2014, 06:57 AM	#4
Baseless Member Location: Germany Join Date: Feb 2010 Posts: 32	This is like writing an email and forgetting to actually put the attachment in place...sorry for the unconvenience, I edited the first response.