ATAC-seq (Read1/Read2/Index Sequencing Primers?)

emacalate · 08-02-2016, 10:14 AM

Hi,

We recently prepared samples for ATAC-seq using primers from the Buenrostro et al paper.

Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad2.1 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

Does anyone know the Read1/Read2/Index primers to use to read out sequences from ATAC-libraries on the Illumina sequencer (for paired end sequencing)? Are these custom primers?

I was told to use Nextera sequencing primers, but I can't figure out how these work for ATAC-libraries. Maybe I have the wrong sequences downloaded?

Any help would be greatly appreciated!

Thanks,

Steve

SeleneT · 08-30-2016, 12:11 PM

Hello,
if you're sequencing on Illuminas NextSeq, their sequencing kits higher than v2 include Nextera primers.
I presume the most recent versions of HiSeq kits should be the same, though I've yet to sequence with them, so check with Illumina tech support or whomever you'll be sequencing with to be sure.
If not, or you're planning to use an older chemistry version kit, the Nextera kit should have come with indexing primers. Check with Illumina's web site for correct dilutions to add, or your sequencing service provider should be able to help. Happy sequencing!
Selene.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
How to know whether its Read1(Forward) or Read2(Reverse) from fastq contents.	vaibhavvsk	Illumina/Solexa	3	12-24-2015 04:23 AM
BWA aligned pairs read1=XT:A:U, read2=XT:A:R	jflowers	Bioinformatics	1	07-29-2014 11:06 PM
How do the Nextera Read1 and Read2 primers both work	Phage434	Illumina/Solexa	6	12-22-2013 06:29 AM
Read1 and Read2 are not consistent	priya	Illumina/Solexa	2	07-16-2013 03:42 AM
Current read1, index, and read2 primers for HiSeq2000	SeqVicious	Illumina/Solexa	1	09-26-2011 03:12 PM

08-02-2016, 10:14 AM	#1
emacalate Junior Member Location: Cleveland Join Date: Dec 2014 Posts: 1	ATAC-seq (Read1/Read2/Index Sequencing Primers?) Hi, We recently prepared samples for ATAC-seq using primers from the Buenrostro et al paper. Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG Ad2.1 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT Does anyone know the Read1/Read2/Index primers to use to read out sequences from ATAC-libraries on the Illumina sequencer (for paired end sequencing)? Are these custom primers? I was told to use Nextera sequencing primers, but I can't figure out how these work for ATAC-libraries. Maybe I have the wrong sequences downloaded? Any help would be greatly appreciated! Thanks, Steve

08-30-2016, 12:11 PM	#2
SeleneT Junior Member Location: La Jolla, CA Join Date: Aug 2016 Posts: 2	ATAC sequencing primers Hello, if you're sequencing on Illuminas NextSeq, their sequencing kits higher than v2 include Nextera primers. I presume the most recent versions of HiSeq kits should be the same, though I've yet to sequence with them, so check with Illumina tech support or whomever you'll be sequencing with to be sure. If not, or you're planning to use an older chemistry version kit, the Nextera kit should have come with indexing primers. Check with Illumina's web site for correct dilutions to add, or your sequencing service provider should be able to help. Happy sequencing! Selene.