Script to make sequences equal length

DCseq · 10-05-2018, 06:13 AM

Hi!
I would like to perform a motif analysis with my ChIP-Seq data on meme-suite.
The program requires me to put in sequences of equal length.
I have the nucleotide sequences from the regions where our protein of interest bound to in ChIP-Seq. These regions are of varying length.
I would like to make them of equal length by figuring out the sequence of greatest length and adding 'N's to both ends of the remaining sequences.
Anyone done this/has a R script?
Many thanks for your feedback in advance!

Richard Finney · 10-05-2018, 06:59 AM

This does not "add to both ends", I think I need a little more information to do that.

Here's a solution that appends "N"s.
It's not R, it's an awk "one liner" (a long one liner) :

cat yourseqfile | awk '{ a[count++] = $0; if (length($0)>l)l=length($0) } END { for (i=0; i<count; i++) { printf("%s",a[i]); for (j=length(a[i]); j<l; j++) printf "N"; printf("\n"); } }'

example:
bash-3.2$ cat yourseqfile
START

A
ACGTACGTACGTACGTACGTACGT
ACGTACGTACGTAC
ACGT
DONE

bash-3.2$ cat yourseqfile | awk '{ a[count++] = $0; if (length($0)>l)l=length($0) } END { for (i=0; i<count; i++) { printf("%s",a[i]); for (j=length(a[i]); j<l; j++) printf "N"; printf("\n"); } }'
STARTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
ANNNNNNNNNNNNNNNNNNNNNNN
ACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACNNNNNNNNNN
ACGTNNNNNNNNNNNNNNNNNNNN
DONENNNNNNNNNNNNNNNNNNNN

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
program which can make a pair end to have equal number of sequence	dejavu2010	Bioinformatics	29	10-07-2019 06:35 PM
script for SOAP de novo to make use of illumina short read data	muralis.bio	Bioinformatics	0	09-05-2015 08:48 AM
Perl script: Make Statistics Of Mirna Abundances For Many Samples	pony2001mx	Bioinformatics	6	05-04-2014 06:12 PM
how to use bash script to make iterative loop through directory with two file types	jddavis	Bioinformatics	2	05-23-2013 08:02 AM
< Script to compute distribution length of sequences >	Giorgio C	Bioinformatics	8	08-23-2012 03:29 AM

10-05-2018, 06:13 AM	#1
DCseq Junior Member Location: Germany Join Date: Jul 2017 Posts: 6	Script to make sequences equal length Hi! I would like to perform a motif analysis with my ChIP-Seq data on meme-suite. The program requires me to put in sequences of equal length. I have the nucleotide sequences from the regions where our protein of interest bound to in ChIP-Seq. These regions are of varying length. I would like to make them of equal length by figuring out the sequence of greatest length and adding 'N's to both ends of the remaining sequences. Anyone done this/has a R script? Many thanks for your feedback in advance!

10-05-2018, 06:59 AM	#2
Richard Finney Senior Member Location: bethesda Join Date: Feb 2009 Posts: 700	This does not "add to both ends", I think I need a little more information to do that. Here's a solution that appends "N"s. It's not R, it's an awk "one liner" (a long one liner) : cat yourseqfile \| awk '{ a[count++] = $0; if (length($0)>l)l=length($0) } END { for (i=0; i<count; i++) { printf("%s",a[i]); for (j=length(a[i]); j<l; j++) printf "N"; printf("\n"); } }' example: bash-3.2$ cat yourseqfile START A ACGTACGTACGTACGTACGTACGT ACGTACGTACGTAC ACGT DONE bash-3.2$ cat yourseqfile \| awk '{ a[count++] = $0; if (length($0)>l)l=length($0) } END { for (i=0; i<count; i++) { printf("%s",a[i]); for (j=length(a[i]); j<l; j++) printf "N"; printf("\n"); } }' STARTNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNN ANNNNNNNNNNNNNNNNNNNNNNN ACGTACGTACGTACGTACGTACGT ACGTACGTACGTACNNNNNNNNNN ACGTNNNNNNNNNNNNNNNNNNNN DONENNNNNNNNNNNNNNNNNNNN Last edited by Richard Finney; 10-05-2018 at 07:18 AM.