SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
P6C4 has higher error rate than P5C3? ymc Pacific Biosciences 4 10-07-2015 06:30 PM
Getting much higher coverage with bowtie2 than tophat2 Studentlost RNA Sequencing 34 01-09-2015 07:39 AM
Is nucleotide diversity higher than expected by chance? JackieBadger Bioinformatics 1 02-21-2013 03:15 AM
Higher RPKMs in Longer Isoforms... Carlo RNA Sequencing 0 03-22-2012 01:53 PM
Why do some Ns have higher quality values than other Ns? lcollado Illumina/Solexa 2 08-26-2010 09:17 PM

Reply
 
Thread Tools
Old 11-01-2015, 02:40 PM   #1
stefan_bioinf
Junior Member
 
Location: Poland

Join Date: Nov 2015
Posts: 1
Question GSNAP: align_score higher than set in -m

Hi All,

I'd like to clarify something which I find odd on my GSNAP output.

I ran GSNAP (version 2015-09-29) like this (i.e. maximally 2 mismatches):

Code:
gsnap -d mm9 -s /usr/local/share/mm9/mm9.maps/mm9.iit -m 2 -i 1 -n 1 --quiet-if-excessive poly_coll.fasta > results
and my output contains hits like this one:

Code:
>ATGTCACTCCAATGAAAGCCTTGG	1	100-1
 gtgtgcttgCAATGAAAGCCTTGG	10..24	-chr10:125750727..125750713	start:9..end:0,matches:19,sub:0	segs:1,align_score:5,mapq:40,method:sa
I concluded that maybe due to the trimming the mismatches at the beginning don't count (sub:0), although it clearly stands: align_score:5. Therefore, I switched trimming off using --trim-mismatch-score and --trim-indel-score flags:

Code:
gsnap -d mm9 -s /usr/local/share/mm9/mm9.maps/mm9.iit -m 2 -i 1 -n 1 --quiet-if-excessive --trim-mismatch-score=0 --trim-indel-score=0 poly_coll.fasta > results
An I still get:

Code:
>ATGTCACTCCAATGAAAGCCTTGG	1	100-1
 gTGTgctTgCAATGAAAGCCTTGG	1..24	-chr10:125750736..125750713	start:0..end:0,matches:19,sub:5	segs:1,align_score:5,mapq:40,method:sa
sub increased to 5 and align_score stays 5. Why have I got this hit in my results?

What's more, I get:

Code:
>GGAGGAAAAAGTCACAGAAGAAGTGGCTG	1	101-1
 aggcagacAAGTCACAGAAGAAGTGGtgG	9..29	-chr2:36642591..36642571	start:8..end:0,matches:19,sub:2	segs:1,align_score:2,mapq:40
which got trimmed, even though I turned trimming off.

I guess I'm missing something, please help.

Thanks in advance
Stefan
stefan_bioinf is offline   Reply With Quote
Reply

Tags
gmap, gsnap

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:56 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO