I tried to use SOCS to map Solid reads (50bp long each) to a set of reference sequences (with varying length, 50bp and longer each). Basically, I used default parameter settings: tolerance and mismatch sensitivity set to 2.
In the output file "alignments.txt", I found one alignment as follows,
one of the reads:
TAATTGATCTAGATAGTGTTCGGCTGATCCATTCGGAAACAGGAAAACACG
is aligned to the reference sequence:
TAATTGATCTAGATAGTGTTCGGCTGATCCAAAGCCTTTGTCCTTTCACATG
the first 31nts of the read and the aligned reference sequence are the same, but the rest part of the read is complement to the reference sequence. Seems only the first part of the read is used for alignment. Is this result reasonable? Any suggestions are highly appreciately!
In the output file "alignments.txt", I found one alignment as follows,
one of the reads:
TAATTGATCTAGATAGTGTTCGGCTGATCCATTCGGAAACAGGAAAACACG
is aligned to the reference sequence:
TAATTGATCTAGATAGTGTTCGGCTGATCCAAAGCCTTTGTCCTTTCACATG
the first 31nts of the read and the aligned reference sequence are the same, but the rest part of the read is complement to the reference sequence. Seems only the first part of the read is used for alignment. Is this result reasonable? Any suggestions are highly appreciately!
Comment