SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
illumina/454 de novo hybrid cDNA assembly with newbler2.6 Seqasaurus Bioinformatics 2 01-23-2012 08:20 AM
hybrid assembly Illumina/454 Robby Bioinformatics 1 09-01-2011 12:54 AM
De novo hybrid assembly of 454/illumina : CLC workbench Bardj Bioinformatics 1 11-21-2010 04:14 PM
Discussion about MIRA hybrid assembly of 454 reads with Illumina unpaired data edge De novo discovery 5 11-16-2009 01:17 AM
Roche 454 + Illumina/Solexa hybrid assembly strategies RajAgainstTheMachine Bioinformatics 2 09-10-2009 11:23 AM

Reply
 
Thread Tools
Old 09-05-2010, 03:38 PM   #1
intikhab
Junior Member
 
Location: KAUST, KSA

Join Date: Sep 2010
Posts: 3
Default Denovo Hybrid Assembly using 454/illumina

Hi,

I have managed to get a reasonable assembly of a bacterial genome using newbler based on 454 NG sequence data.

I have also available paired end reads for the same bacterial genome and I am wondering is there a way to improve the contigs and scaffolding.

I read about AMOS-hybrid, http://www.biomedcentral.com/1471-2164/11/242, but it requires mates file, which I do not have available instead I have one sequence file for each of the paired ends.

I also thought to try mira but it also requires mates files. Should I request the vender for mates file or there are other software available that can use contigs from my newbler run and raw paired end files and their qualities?

I hope other people may have gone through hybrid assembly issue already and may be of help.

Regards,

Intikhab
intikhab is offline   Reply With Quote
Old 09-06-2010, 12:33 AM   #2
andreas.sjodin
Member
 
Location: Umeň, Sweden

Join Date: Apr 2009
Posts: 27
Default

I would refer you to the BAMBUS manual where you find a description of the mates format:

http://sourceforge.net/apps/mediawik...he_.mates_file

You may also find an example in the test folder of AMOS-Hybrid.
Quote:
library fiveK 4000 6000 (r).*
pair (.*)\.1 (.*)\.2
The first row describes the library information and the second row contains mate-pair relationships. You may create your own mate-file based on information your own library and read structure.
andreas.sjodin is offline   Reply With Quote
Old 09-06-2010, 05:02 AM   #3
themerlin
Member
 
Location: Flagstaff, AZ

Join Date: Feb 2010
Posts: 51
Default

Quote:
Originally Posted by intikhab View Post
Hi,

I have managed to get a reasonable assembly of a bacterial genome using newbler based on 454 NG sequence data.

I have also available paired end reads for the same bacterial genome and I am wondering is there a way to improve the contigs and scaffolding.
If you wanted to use Mira, there are instructions on how to directly use Mira with Bambus:

http://mira-assembler.sourceforge.ne...IRA_BAMBUS.pdf
themerlin is offline   Reply With Quote
Old 09-15-2010, 09:34 AM   #4
intikhab
Junior Member
 
Location: KAUST, KSA

Join Date: Sep 2010
Posts: 3
Default

About the mates file, if I have the following description of the paired ends reads:

>NG-5247_HLP_3_1_1058_5238/1
ATGATGCATCTGAGACGATNGGTGTAAACGATCGT

>NG-5247_HLP_3_1_1058_5238/2
ACAAGATATATACGTATTATTAGGGTCAATAATGG

How should the mates file look a like?:

library NG-5247 150 200 (^NG).*
pair (.*)\/1 (.*)\/2


One related question. When we have two separate files for paired end reads, how can one provide these to mira or AMOS-Hybrid, these programs require one file. Does, jut combining the two e.g. using cat a b >c should do?

Intikhab

Quote:
Originally Posted by andreas.sjodin View Post
I would refer you to the BAMBUS manual where you find a description of the mates format:

http://sourceforge.net/apps/mediawik...he_.mates_file

You may also find an example in the test folder of AMOS-Hybrid.


The first row describes the library information and the second row contains mate-pair relationships. You may create your own mate-file based on information your own library and read structure.
intikhab is offline   Reply With Quote
Old 09-15-2010, 03:06 PM   #5
sbberes
Member
 
Location: Houston TX

Join Date: Jan 2009
Posts: 22
Default

I suggest checking MIRA again, I think that you are in error in thinking that it requires mates files. I have used MIRA with good results doing hybrid assemblies of single end read 454 and illumina data. See the thread: "Combining 454FLX and SOLiD runs for de novo genome assembly", I outlined the process that I used there.
SBB
sbberes is offline   Reply With Quote
Old 09-16-2010, 03:54 AM   #6
intikhab
Junior Member
 
Location: KAUST, KSA

Join Date: Sep 2010
Posts: 3
Default

Here I am using AMOS-Hybrid, where mates file is required. For mira I know we dont need mates file, what we need there is a caf file from an initial assembly and sequence file from the second technology.

Can anybody correct me on the mates file, mentioned above. When I use this, the error log shows a large number of reads got excluded.

I want to know specifically the regular expression for the library and for the forward and reverse reads, I have mentioned the description of forward and reverse reads above.

Regards,

Intikhab
intikhab is offline   Reply With Quote
Reply

Tags
hybrid assembly, mates, newbler, paired ends

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:47 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO