SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
bwa sampe segmentation fault papori Bioinformatics 5 09-22-2013 10:05 PM
BWA Alignment Segmentation Fault adkostic Bioinformatics 24 09-09-2013 12:52 AM
bwa samse segmentation fault xguo Bioinformatics 78 05-03-2013 10:31 AM
segmentation fault in BWA sampe papori Illumina/Solexa 0 07-28-2011 08:12 AM
bwa aln Segmentation fault DNAjunk Bioinformatics 4 03-02-2011 06:28 AM

Reply
 
Thread Tools
Old 05-18-2010, 06:41 AM   #1
raela
Member
 
Location: Ithaca, NY

Join Date: Apr 2010
Posts: 39
Default BWA Segmentation Fault (aln)

I'm trying to align 79 bp illumina reads to the horse genome. I'm using a 64 bit system with 8 GB ram. It fails within seconds, using 37,958 reads. Any ideas on how to get bwa working?

example read:
@ILLUMINA-904D83_0001:6:1:1514:5295#0/1-unm
TGCTGCGGAGGGAGAGAAAGAGGAGGCTTGTAAATGGACTGTTATTCTTCCCCTGGACTCTGTGGTACACATAGGCGC
+
CCCCCCCCCCCCCCCCCACC1CC@C=AAA2@CCCC2A+AA?CCCCCBC*@AAA+;>@8@A%%%%%%%%%%%%%%%%%%!

(gdb) run aln equcab2.fa unm.fq
Starting program: /usr/local/genome/bin/bwa aln equcab2.fa unm.fq
[Thread debugging using libthread_db enabled]
[bwa_aln] 17bp reads: max_diff = 2
[bwa_aln] 38bp reads: max_diff = 3
[bwa_aln] 64bp reads: max_diff = 4
[bwa_aln] 93bp reads: max_diff = 5
[bwa_aln] 124bp reads: max_diff = 6
[bwa_aln] 157bp reads: max_diff = 7
[bwa_aln] 190bp reads: max_diff = 8
[bwa_aln] 225bp reads: max_diff = 9



[bwa_aln_core] calculate SA coordinate... [New Thread 0x7f01b0c4b6f0 (LWP 24977)]

Program received signal SIGSEGV, Segmentation fault.
[Switching to Thread 0x7f01b0c4b6f0 (LWP 24977)]
bwt_2occ (bwt=0x636a10, k=4294967295, l=904726057, c=1 '\001',
ok=0x7fff4f2880e4, ol=0x7fff4f2880e0) at bwt.c:100
100 bwt.c: No such file or directory.
in bwt.c
(gdb) bt
#0 bwt_2occ (bwt=0x636a10, k=4294967295, l=904726057, c=1 '\001',
ok=0x7fff4f2880e4, ol=0x7fff4f2880e0) at bwt.c:100
#1 0x000000000040518b in bwt_cal_width (rbwt=0x636a10, len=78,
str=0x637400 "\001\003\001\003\001\003\001\002\001\003\001",
width=0x12f72e0) at bwtaln.c:63
#2 0x00000000004054b9 in bwa_cal_sa_reg_gap (tid=0, bwt=0x7fff4f288280,
n_seqs=37958, seqs=<value optimized out>, opt=0x62f010) at bwtaln.c:121
#3 0x0000000000405a91 in bwa_aln_core (prefix=0x7fff4f28a592 "equcab2.fa",
fn_fa=<value optimized out>, opt=0x62f010) at bwtaln.c:185
#4 0x0000000000405e51 in bwa_aln (argc=251, argv=0x7fff4f2883f0)
at bwtaln.c:297
#5 0x00007f01b0056526 in __libc_start_main () from /lib64/libc.so.6
#6 0x0000000000401869 in _start () at ../sysdeps/x86_64/elf/start.S:113
raela is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:57 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO