SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Merging Velvet Assemblies millermr Bioinformatics 20 02-26-2015 12:02 PM
merging scaffolds from several SOAPdenovo assemblies into a single consensus assembly jstjohn Bioinformatics 10 08-13-2014 04:39 AM
Comparing and merging genome assemblies megh Bioinformatics 5 07-23-2014 03:58 AM
Merging genomic Assemblies rahularjun86 De novo discovery 0 02-03-2012 02:08 AM
Merging Velvet Assemblies millermr General 0 11-23-2010 08:59 PM

Reply
 
Thread Tools
Old 05-19-2011, 05:15 AM   #1
SLB
Member
 
Location: Ireland

Join Date: Sep 2010
Posts: 21
Default Merging Assemblies with Minimus2

I am trying to use Minimus2 to merge abyss assemblies. I also want to use it to run my assemblies against some 454 reads to try and get better value from these longer reads. I managed to get it working with a smaller test set but having difficulty with larger concatenated files from the assemblies.

Is there a limit to the size of the input data that can be handled by miniums2?

I am considering chopping up my assemblies into smaller faster files. I can then merge each file with the 454 data in turn. I could then use a clustering tool (CD-HIT-EST) to merge all the files to remove redundancy. Has anyone any experience/recommendations doing something like this?
SLB is offline   Reply With Quote
Old 05-19-2011, 06:02 AM   #2
SLB
Member
 
Location: Ireland

Join Date: Sep 2010
Posts: 21
Default

Here is one of the problems I am having, when I concatenate two files from an abyss assembly (.fa files) and convert to afg (with toAmos) for use in minimus2 I get the following error.

AFG ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:1, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:2, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:3, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:4, message ignored
and so on for all entries......

I am at a bit of a loss to what is going on.... I don't have quality scores.

here is what fasta file looks like:
>3520 2510 57729
ATATCTCATTTAGCTTCATTTGTATAACATCTGAAAACAAAAGTTAATCTCCACAGTCACAAGATAGCACTGAATTAGGT
TCATACACAGAGGAAGCTAGAAATTGCAGATTGGTTCCGCGCTCCAAGTTTTTTAAAAATGATGCTTAAATACTACCTGA
TACTCTAATCTTTGATGTAATACATGAAGGGAATAAGAAAAACACTTCATACCATGAGTTCATAGTGGTCCCTCACGCTG
CACTTGTCCCTCACGGATACGTCAAA

Last edited by SLB; 05-19-2011 at 06:21 AM.
SLB is offline   Reply With Quote
Old 11-02-2014, 12:50 PM   #3
milo0615
Member
 
Location: Walnut, California

Join Date: Dec 2012
Posts: 39
Default toAmos error

Quote:
Originally Posted by SLB View Post
Here is one of the problems I am having, when I concatenate two files from an abyss assembly (.fa files) and convert to afg (with toAmos) for use in minimus2 I get the following error.

AFG ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:1, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:2, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:3, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:4, message ignored
and so on for all entries......

I am at a bit of a loss to what is going on.... I don't have quality scores.

here is what fasta file looks like:
>3520 2510 57729
ATATCTCATTTAGCTTCATTTGTATAACATCTGAAAACAAAAGTTAATCTCCACAGTCACAAGATAGCACTGAATTAGGT
TCATACACAGAGGAAGCTAGAAATTGCAGATTGGTTCCGCGCTCCAAGTTTTTTAAAAATGATGCTTAAATACTACCTGA
TACTCTAATCTTTGATGTAATACATGAAGGGAATAAGAAAAACACTTCATACCATGAGTTCATAGTGGTCCCTCACGCTG
CACTTGTCCCTCACGGATACGTCAAA

Hi SLB,

Were you able to figure it out? I am having the same error trying to combine abyss output. I am following this protocol: http://ged.msu.edu/angus/metag-assem...et-multik.html

Please let me know if you were able to fix the problem.


Thank you,

-Milo
milo0615 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:10 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO