SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Visualisation issue with mapped BAM file - how do I find my region of interest... TabeaK Bioinformatics 1 11-14-2012 05:06 AM
how to know the genomic coordinate of the exon region of each gene ahli1981 Bioinformatics 1 11-30-2011 12:25 PM
List all genes belonging to a certain genomic region Marius Bioinformatics 3 02-17-2011 11:33 PM
how to get annotation form genomic region? dwb0211 Bioinformatics 7 01-13-2010 09:35 PM

Reply
 
Thread Tools
Old 02-13-2013, 01:31 PM   #1
JenBarb
Member
 
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47
Default Pull read sequences out of a genomic region of interest?

Hello, I am relatively new to this and would like to pull out reads aligned to the mm10 genome to a particular region of interest. I first ran my fastq files in tophat to get bam files. I then ran BamToSam to get the sam files with the read sequences and alignments. I thought it would be as simple as doing a grep on the chromosome I want and looking within those results to pull out the genomic region I want however my Sam file has 21 fields per row where column 3 and column 7 both have chromosomes and I believe that columns 4 and 8 are start locations. I am not clear as to which of these would be the aligned region of the genome? Any thoughts, or advice? Here is a line from my Sam file. Also, I took the sequence and blatted it on mm10 and the 100% returned hits did not match either chromosome? Maybe I am missing something. Any thoughts would be really helpful? thanks.
D192UACXX:7:2212:12464:05542 99 chr1 3035207 50 101M = 3035303 197 GTCCTGATTATGTATCTGATCTGTTAGTCTGTATCATTTTATTAGGGAATACAGTCCATTGATATTAAGAGATATTACAGAAAAAATGATTGTTGCTTCCT CBCFFFFFHHHHHJJJJJHJJJJJJJIHIIIHIIJIJJJIJJJJJJGIJJJJJIJJJJJJIJJJJIHIHIDHIIFHIIJJJJIJHHFF7?DFFEEEEEED AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YT:Z:UU NH:i:1 XS:A:-
JenBarb is offline   Reply With Quote
Old 02-13-2013, 03:06 PM   #2
MeganS
Member
 
Location: US

Join Date: Sep 2010
Posts: 14
Default

You can use "samtools view" to pull out the region of interest (in sam/bam format) and "picard SamToFastq.jar" to pull out the reads from the sam/bam (in fastq format).
MeganS is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:50 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO