SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to get multiple alignment with Multiz? JT Guan Bioinformatics 4 04-17-2013 05:52 AM
Running problem with cuffdiff john_nl Bioinformatics 2 02-16-2012 11:21 AM
The problem of running soapfusion louis7781x Bioinformatics 0 08-03-2011 02:44 AM
Problem running PyroBayes JackieBadger Bioinformatics 1 05-16-2011 09:42 AM
problem running TopHat anecsulea RNA Sequencing 0 05-28-2010 12:44 AM

Reply
 
Thread Tools
Old 07-21-2013, 01:05 PM   #1
koustavpal
Member
 
Location: Asia

Join Date: Aug 2012
Posts: 14
Default problem running multiz with MAF files

i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

a score=21045.000000
s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

a score=21045.000000
s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

and this problem is common in all files where i have made this change
it would be really helpful if someone can point out the problem here.

the multiz command i use is

multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


and the command i used to change them was:

awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2
koustavpal is offline   Reply With Quote
Old 07-23-2013, 10:21 PM   #2
koustavpal
Member
 
Location: Asia

Join Date: Aug 2012
Posts: 14
Default bump

not to spam or anything but i really need help on this. so bump!
koustavpal is offline   Reply With Quote
Old 08-18-2015, 01:39 PM   #3
milo0615
Member
 
Location: Walnut, California

Join Date: Dec 2012
Posts: 39
Default

Hi koustavpal,

Were you able to figure it out? What was causing the problem? what Phastcons command did you use? I am in the same situation. Please let me know.


thank you,

-Milo

Quote:
Originally Posted by koustavpal View Post
i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

a score=21045.000000
s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

a score=21045.000000
s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

and this problem is common in all files where i have made this change
it would be really helpful if someone can point out the problem here.

the multiz command i use is

multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


and the command i used to change them was:

awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2
milo0615 is offline   Reply With Quote
Old 08-18-2015, 11:56 PM   #4
koustavpal
Member
 
Location: Asia

Join Date: Aug 2012
Posts: 14
Default

Hi milo,

I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

Maybe you can start there if you haven't already.

On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.
koustavpal is offline   Reply With Quote
Old 08-19-2015, 03:25 PM   #5
milo0615
Member
 
Location: Walnut, California

Join Date: Dec 2012
Posts: 39
Default

Hi koustavpal,

Thank you for the quick reply. I am currently aligning two de novo plant genomes (wild and domesticated genomes) and I am using a related plant genome as reference. My goal is to analyse the genetic diversity and differentiation within and between the domesticated and wild plant. I have already completed the alignment using LASTZ and combined the MAF alignments using MULTIZ but I am confused on what would be my next step. What would you recommend? Should I continue with the LASTZ pipeline or do you have a better method in mind? I would really appreciate your help.


Regards,

-Milo

Quote:
Originally Posted by koustavpal View Post
Hi milo,

I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

Maybe you can start there if you haven't already.

On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.
milo0615 is offline   Reply With Quote
Reply

Tags
multiple alignment, multiz

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:43 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO