SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie2 Local Alignment Mode SHeaph Bioinformatics 4 04-18-2013 03:45 PM
unique alignment in the new version of Bowtie2 eraney Bioinformatics 0 08-29-2012 11:40 PM
After doing Bowtie2 alignment I ended up in less data. ssn4ssn Bioinformatics 4 05-29-2012 08:16 AM
Bowtie2 / Bowtie 2 gapped alignment hanshart Bioinformatics 0 03-15-2012 08:52 AM
Myrna stops in paired bowtie alignment Serena Rhie RNA Sequencing 4 09-19-2010 03:04 AM

Reply
 
Thread Tools
Old 12-27-2012, 02:24 AM   #1
moritzhess
Member
 
Location: freiburg

Join Date: Apr 2010
Posts: 25
Default bowtie2 stops during alignment

Hi everybody,

I am aligning Illumina 100bp reads to a reference transcriptome using bowtie2. When aligning certain fastq files, bowtie stops aligning always at the same position. The first read, below is the last that bowtie aligns. Afterwards bowtie stops. I ran fastqc on the files anyway and it reported no errors. Bases and Quality strings seem to have the same length so I cannot find a reason for the alignment stop. Does anybody had the same sort of errors when using bowtie2 ?

Thanks in advance,

Moritz

@HWI-ST748:181:D1K3YACXX:6:1101:20680:72912 1:N:0:ACTTGA
GTGCAACAGTACCAGCAACAAATGAAGGTAAAACACCTCGATTTCTGTGCATTCAATGTTCCTCGACTTCTGTGCAGCAATCTCTCTTCTGGAAAATCGT
+
@@CFDFFFHFFDDFFEBFDH?ECHGIIJAEDHICGG1?FHBGIIDHIGEEAFIGH>BBBDGEGIJJ/@[email protected]:[email protected];6;>@[email protected]>:7?
@HWI-ST748:181:D1K3YACXX:6:1101:20630:72949 1:N:0:ACTTGA
GTTGTAACTGACCGGATCGCAGGCAGATTGCCCCAGCTTTAAATTAGTCATTGTTGGCGATGGAGGCACTGGGAAGACGACTTTTGTCAAACGCCATCTT
+
CCCFFFFFHHHHHJJJJIJJJJJJJJIJFJEHJJJJJJJJIIIGHHIGGIJJJJJIJIHHFFFEEDBBDDCDD?C?BDDDDDDDDDDDEEDDDDDDDDCC
@HWI-ST748:181:D1K3YACXX:6:1101:20750:72956 1:N:0:ACTTGA
ATGAACTTCAAGCTCTGACTGAGAAAGCCGTTATTCACGATTGGAAGGAGACCGAGTCTTGGAGGCTGTTGAAGCAGCTCACTAAATCAGTTCAACATCG
moritzhess is offline   Reply With Quote
Old 12-27-2012, 03:47 AM   #2
Luyi Tian
Member
 
Location: HangZhou_China

Join Date: Mar 2012
Posts: 15
Default

Does the program print any error message? or it just stoped.
Luyi Tian is offline   Reply With Quote
Old 12-27-2012, 03:58 AM   #3
moritzhess
Member
 
Location: freiburg

Join Date: Apr 2010
Posts: 25
Default

Hi Luyi Tian,
thanks for your fast response!
The program itself is quiet but I piped the bowtie output to samtools view to generate bam files and samtools reports: "Parse error at line 1299638: sequence and quality are inconsistent."

Moritz
moritzhess is offline   Reply With Quote
Old 01-13-2013, 04:53 AM   #4
moritzhess
Member
 
Location: freiburg

Join Date: Apr 2010
Posts: 25
Default

Problem solved by upgrading to Version 2.0.5.
moritzhess is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:03 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO