Adaptor order in PE sequencing

[Sakti]

Dear all,

This might be a stupid question, but it's better asking than wasting a whole lane of HiSeq (and my PI hating me for the rest of my degree ).

I have different regions I'd like to amplify using PCR with primers that already have ligated Illumina PE adaptors to them, as in the following scheme:

Forward primer: [P1adaptor][forward.primer.sequence]
Reverse primer: [P2adaptor][reverse.primer.sequence]

So the PCR product would look something like:

[P1adaptor][forward.primer.sequence]XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX[reverse.primer.sequence][P2adaptor]

My question is, would it matter if I swap the order of adaptors so that instead of forward primer having PE1 adaptor it has PE2??

Like this:

Reverse primer: [P1adaptor][reverse.primer.sequence]
Forward primer: [P2adaptor][forward.primer.sequence]

I think it shouldn't alter anything, just basically the order in which the primer sequence is reported (reverse primer now being reported in the 1st PE reads rather than the 2nd reads).

Thanks!!!

[kcchan]

Just to clarify, are you trying to swap just the PCR primer or the sequencing primer? If you choose to swap one you'll have to swap the other or your primers will be in the wrong direction.

[Sakti]

Just to clarify, are you trying to swap just the PCR primer or the sequencing primer? If you choose to swap one you'll have to swap the other or your primers will be in the wrong direction.

Good point, I'm just swaping the sequencing primer (either P1 or P2), not the primer that binds and amplifies the sequence.

i.e

forward primer: ATGAGGGTCCAATCCATAAGC
rev primer: AGAGACATCGGTCTCTGATGGT

With adaptors:

for with P1:
AATGATA...CGCTCTTCCGATCTATGAGGGTCCAATCCATAAGC

rev with P2:
CAAGCAG...CTCTTCCGATCTAGAGACATCGGTCTCTGATGGT


What I want to do is:

for with P2:
CAAGCAG...CTCTTCCGATCTATGAGGGTCCAATCCATAAGC

rev with P1:
AATGATA...CGCTCTTCCGATCTAGAGACATCGGTCTCTGATGGT

I want to know if that alters the PCR reaction itself (i.e. primers going outwards instead of amplifying into the region I want)

[kcchan]

Your primers aren't going outwards. All you're doing is flipping the amplicon upside down so that read 1 becomes read 2 and vice versa.

[Sakti]

Your primers aren't going outwards. All you're doing is flipping the amplicon upside down so that read 1 becomes read 2 and vice versa.

Thank you very much