What is the specification of dbSNP?

[Applemelon]

I downloaded from NCBI dbSNP a file, whose format is something like fasta. Here is one example:

>gnl|dbSNP|ss244318098 ss=244318098|pos=394|len=894|handle="BGI"|subid="Gm01-394"|taxid=3847|mol="Genomic"|class=1|alleles="A/C"
GGTTTGGTGTTTGGGTTTTAGGTTTTAGGTTTTAGGTTTTACGGTTTAGGGTTTATGGTTTATGGTTTAGGGTTTAGGGT
TAGGAAATAATTTGGGTCTTTCATCTTTCAACAAAAAATTAAGGGATTTAGAGTAATTTTTAGGGTTTAGGGTTTAAGGT
TTTAGGTTTCGGGTTTGGGTTTTAGATTTTACGGCTTACGGTTTAAAGTTTAGGGGTTAGGGTTTAGGGTTTAGAAATAA
ATTTGAGTGTTTGACATTTGAACACAAAATTAAGGCATTTAGAGTCATTTTTAGGGTTTACGGTTTAGGGTTTAGCAAGA
AATTTCGGTGTTTCATCTTCGAACACAAAATTAAGGCAGTTAAAGTCTTTTTTTGGGTTTAGGGTTTAGGGTT
M
TTTGCCTGGGTGTGCCAGTGGCGTGAGCAAATGGAGGGCGGCCATTTCTCATGTTTGGACGTCAAAGAACCCATAAAAAA
TAGTCCTGTTCCCCGGTTTCGTCAACTAACACGTAAAAACAATGCCTTAACACAAAATTAAGGCATTTAGAGGCATTTTT
AGGGTTTACGGTTTAGGGTTTACCAAGAAATTTCGGTGTTTCATCTTTGAACACAAAATTAAGGCAGTTAAAGTCTTTTT

I was confused by "class=1“ in the header and "M" in the body. What are their meanings? How to transfer this format to VCF format? I can't find VCF file of soybean. Thank you very much.

[ulz_peter]

The lonesome "M" in the middle of the text is IUPAC Ambiguity Code. This is used if you want to state that two or more bases are likely to be in the same position. In this case the letter M is short for aMino, which means there can be either C or A at that position.

I don't think it is possible to generate a VCF file from just having this position, since it neither states a chromsome nor a position for that SNP, which is necessary for creating a VCF.

If you've got a lot of time you might align those seuqences and then annotate the missing infomration to get a VCF file, but there might be easier solutions for that