Dear users,
I'm using BFAST to align miRNA reads from SOLiD ABI to the precursor miRNA reference.
I can't understand one thing.
When I used the reference of miRNA precursor as (for example):
>hsa-mir-548d-1 MI0003668 Homo sapiens miR-548d-1 stem-loop
AAACAAGUUAUAUUAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCUGUAAAAGUAAUGG
CAAAAACCACAGUUUCUUUUGCACCAGACUAAUAAAG
>hsa-mir-661 MI0003669 Homo sapiens miR-661 stem-loop
GGAGAGGCUGUGCUGUGGGGCAGGCGCAGGCCUGAGCCCUGGUUUCGGGCUGCCUGGGUC
UCUGGCCUGCGCGUGACUUUGGGGUGGCU
...
...
(extracted by miRBasev13)
the program returns me the error at the localalign step saying me that read and reference don't match.
If I use the same reference, adding to each miRNA sequence 35 N (at the begin and at the end of each one), as, for example:
>hsa-mir-1277
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTCCCAAATATATATATATATGTACGTATGTGTATATAAATGTATACGTAGATATATATGTATTTTTGGTGGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>hsa-mir-1278
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGCTCATAGATGATATGCATAGTACTCCCAGAACTCATTAAGTTGGTAGTACTGTGCATATCATCTATGAGCGAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
...
...
the program runs and I can terminate my alignment.
So, I don't know how to explain it to myself!
I then compared the number of counts found by BFAST program (about 75000) with the counts found by the RNA_pipeline of corona lite (ABI) (about 22000).
How can I explain this so large difference?
Thank you very much for the help!
Maria Elena
I'm using BFAST to align miRNA reads from SOLiD ABI to the precursor miRNA reference.
I can't understand one thing.
When I used the reference of miRNA precursor as (for example):
>hsa-mir-548d-1 MI0003668 Homo sapiens miR-548d-1 stem-loop
AAACAAGUUAUAUUAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCUGUAAAAGUAAUGG
CAAAAACCACAGUUUCUUUUGCACCAGACUAAUAAAG
>hsa-mir-661 MI0003669 Homo sapiens miR-661 stem-loop
GGAGAGGCUGUGCUGUGGGGCAGGCGCAGGCCUGAGCCCUGGUUUCGGGCUGCCUGGGUC
UCUGGCCUGCGCGUGACUUUGGGGUGGCU
...
...
(extracted by miRBasev13)
the program returns me the error at the localalign step saying me that read and reference don't match.
If I use the same reference, adding to each miRNA sequence 35 N (at the begin and at the end of each one), as, for example:
>hsa-mir-1277
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTCCCAAATATATATATATATGTACGTATGTGTATATAAATGTATACGTAGATATATATGTATTTTTGGTGGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>hsa-mir-1278
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGCTCATAGATGATATGCATAGTACTCCCAGAACTCATTAAGTTGGTAGTACTGTGCATATCATCTATGAGCGAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
...
...
the program runs and I can terminate my alignment.
So, I don't know how to explain it to myself!
I then compared the number of counts found by BFAST program (about 75000) with the counts found by the RNA_pipeline of corona lite (ABI) (about 22000).
How can I explain this so large difference?
Thank you very much for the help!
Maria Elena
Comment