SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Exclude chrM, chrUn* from reference // htseq-count warning on chrM ocs Bioinformatics 10 11-02-2011 11:21 AM
cuffcompare warning message Robin Bioinformatics 8 10-26-2011 11:14 AM
htseq-count with warning for every read to represent all of zero counts in output hibachings2013 RNA Sequencing 10 07-15-2011 11:19 AM
Warning message- BFAST CS Student General 2 05-26-2011 11:56 AM
Orthomcl warning message joscarhuguet Bioinformatics 0 04-20-2011 09:13 AM

Reply
 
Thread Tools
Old 05-21-2013, 05:05 AM   #1
canhu
Member
 
Location: beijing,china

Join Date: May 2013
Posts: 11
Unhappy HTSeq-count warning message

Hello,

i have been spent many hours counting the reads from tophat output file, accepted_hits.bam. before tophat mapping, bowtie2-bulid was used to bulid index of genome.
when i use HTseq-count to count the bam, I try a lot of ways, including sort the file, cut off the last number (_0 or _1) of paired-end reads name ,but warning message still appear.

frist, i use samtools to check the status of bam file,
>samtools flagstat accepted_hits.bam
1114298 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 duplicates
1114298 + 0 mapped (100.00%:-nan%)
1114298 + 0 paired in sequencing
1049578 + 0 read1
64720 + 0 read2
30176 + 0 properly paired (2.71%:-nan%)
60650 + 0 with itself and mate mapped
1053648 + 0 singletons (94.56%:-nan%)
29714 + 0 with mate mapped to a different chr
23484 + 0 with mate mapped to a different chr (mapQ>=5)

i use samtools to sort and convert bam file, and get sam file
HTseq-count -s no accepted_sorted.sam zebrafish.gtf > htcount
Warning: Read HWI-ST507_74_2_68_21290_5843_0_0_2 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
Warning: Read HWI-ST507_74_2_68_21292_174160_0_0_2 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
Warning: Read HWI-ST507_74_2_68_21350_3889_0_1_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
...
...
...
Warning: Read HWI-ST507_74_2_68_21353_180091_0_0_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
Warning: Read HWI-ST507_74_2_68_21353_180091_0_0_2 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
1114298 sam line pairs processed.

i check the message of HWI-ST507_74_2_68_21353_180091 read,
HWI-ST507_74_2_68_21353_180091_0_0_1 83 GL831154.1 4572842 50 81M = 4572839 -84 TGATCAGGTGCTATTAAAGCATAGCTATTGACCGAGTATCTGCATGGTGGCAGCCTTTCCAAAGCTGGACTCGTCCCTTTT BB_VY_^^`R`Z`[WbU`M[^K]HUP^NSUKV[KZWPZG]OTZYSPOXVO^^]Ra]WS]Y]ZPKXFLMPXFXPMQF[^^aa AS:i:-11 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:53T21T5 YT:Z:UU NH:i:1
HWI-ST507_74_2_68_21353_180091_0_0_2 163 GL831154.1 4572839 50 47M = 4572842 84 GCTTGATCAGGTGCTATTAAAGGATAGCTATTGACCGAGTATCTGCT b^ab`Ma^]bb_aYb]bcbbJZKW\GWU\RbY^[]MaZ[_]\VZ`BB AS:i:-11 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:22C23A0 YT:Z:UU NH:i:1

i see the same problem from previous thread, and i use perl script to change the id of reads, cutting off the _0 or _1.
i check the message of HWI-ST507_74_2_68_21353_180091 read,
HWI-ST507_74_2_68_21353_180091_0_0 83 GL831154.1 4572842 50 81M = 4572839 -84 TGATCAGGTGCTATTAAAGCATAGCTATTGACCGAGTATCTGCATGGTGGCAGCCTTTCCAAAGCTGGACTCGTCCCTTTT BB_VY_^^`R`Z`[WbU`M[^K]HUP^NSUKV[KZWPZG]OTZYSPOXVO^^]Ra]WS]Y]ZPKXFLMPXFXPMQF[^^aa AS:i:-11 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:53T21T5 YT:Z:UU NH:i:1
HWI-ST507_74_2_68_21353_180091_0_0 163 GL831154.1 4572839 50 47M = 4572842 84 GCTTGATCAGGTGCTATTAAAGGATAGCTATTGACCGAGTATCTGCT b^ab`Ma^]bb_aYb]bcbbJZKW\GWU\RbY^[]MaZ[_]\VZ`BB AS:i:-11 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:22C23A0 YT:Z:UU NH:i:1

and run HTSeq-count again and get the output of reads count, warning message still appear. But the result was differ from the last. this is so confusing
__________________

Last edited by canhu; 05-21-2013 at 05:18 AM.
canhu is offline   Reply With Quote
Old 05-21-2013, 05:49 AM   #2
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

The output of tophat is coordinate sorted, but htseq-count is expecting name sorted input. Run the following:
Code:
samtools sort -n accepted.bam name_sorted
You can then use the name_sorted.bam file for counting.
dpryan is offline   Reply With Quote
Old 05-21-2013, 07:28 AM   #3
canhu
Member
 
Location: beijing,china

Join Date: May 2013
Posts: 11
Default

Quote:
Originally Posted by dpryan View Post
The output of tophat is coordinate sorted, but htseq-count is expecting name sorted input. Run the following:
Code:
samtools sort -n accepted.bam name_sorted
You can then use the name_sorted.bam file for counting.
thanks for your reply. The inputfile has been sorted by the samtools, but the warning message still appear as i said
__________________
canhu is offline   Reply With Quote
Old 05-21-2013, 08:42 AM   #4
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

Quote:
Originally Posted by canhu View Post
thanks for your reply. The inputfile has been sorted by the samtools, but the warning message still appear as i said
coordinate or name sorted? The default is the former, but what you need is the latter. You might also quickly ensure that the mates are immediately next to each other in the name-sorted file. A quick "grep -n read" (or equivalent) on the output of "samtools view name_sorted.bam" should prove useful.

FYI, the code for this step in htseq-count appears to be in HTSeq/__init__.py and pretty straight forward. The only reason I can see that you example reads would produce an error is if they're not next to each other in the name-sorted file (or if you have some combination of paired-end and unpaired-reads, I don't know how htseq-count deals with that).
dpryan is offline   Reply With Quote
Old 05-21-2013, 07:02 PM   #5
canhu
Member
 
Location: beijing,china

Join Date: May 2013
Posts: 11
Question

Quote:
Originally Posted by dpryan View Post
coordinate or name sorted? The default is the former, but what you need is the latter. You might also quickly ensure that the mates are immediately next to each other in the name-sorted file. A quick "grep -n read" (or equivalent) on the output of "samtools view name_sorted.bam" should prove useful.

FYI, the code for this step in htseq-count appears to be in HTSeq/__init__.py and pretty straight forward. The only reason I can see that you example reads would produce an error is if they're not next to each other in the name-sorted file (or if you have some combination of paired-end and unpaired-reads, I don't know how htseq-count deals with that).
sorry for my unclearly answer, i sorted it by name indeed.
samtools sort -n accepted_hits.bam accepted_hits_sorted.bam

[[email protected] testsamtools]# grep -n 'HW' t1.sam | head | less -S
5727:HWI-ST507_74_2_1_1061_159707_0_1_1 73 GL831295.1 749518 50 37M * 0 0
5728:HWI-ST507_74_2_1_1064_91610_0_1_1 89 GL831198.1 601776 50 42M * 0 0
5729:HWI-ST507_74_2_1_1065_95848_0_1_1 89 GL831223.1 541546 50 46M * 0 0
5730:HWI-ST507_74_2_1_1066_26959_0_1_1 89 GL831179.1 2843075 50 51M * 0 0
5731:HWI-ST507_74_2_1_1066_32520_0_1_1 73 GL831368.1 364087 50 41M * 0 0
5732:HWI-ST507_74_2_1_1066_87901_0_1_1 89 GL831157.1 3278742 50 46M * 0 0
5733:HWI-ST507_74_2_1_1066_121345_0_1_1 73 GL831133.1 757133 50 71M1180N23M * 0
5734:HWI-ST507_74_2_1_1067_156505_0_1_2 73 GL831133.1 1560596 50 54M * 0 0
5735:HWI-ST507_74_2_1_1068_39194_0_1_1 73 GL831217.1 1219533 50 50M * 0 0
5736:HWI-ST507_74_2_1_1070_8691_0_1_1 89 GL831508.1 190565 50 51M * 0 0
[[email protected] testsamtools]#


from the above information, my data include paired-end and unpaired-reads. Although many warning messages appear, I aslo get the results of read counts . I wonder whether the results were reliable
__________________
canhu is offline   Reply With Quote
Old 05-22-2013, 02:33 AM   #6
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

I would need to go through the code for htseq-count to know exactly how it would handle these situations, so you might be best served by either doing that or just contacting Simon Anders, who wrote it. It would be interesting to go through the samtools mailing list to see if this sort of SAM file is the correct behaviour, as the specification is silent on that. I wouldn't rely on the results without being certain that these are being handled correctly (I somewhat naively worry that these sorts of reads could get htseq-count out of sync with the read pairing).

Alternatively, remove any read with the 0x8 bit in the flag set (since the unmapped mates are already missing, this should just exclude the "rescued" reads). I expect that will get rid of the random unpaired reads. You could also simply rerun tophat with the --no-mixed option.
dpryan is offline   Reply With Quote
Old 05-22-2013, 02:50 AM   #7
Simon Anders
Senior Member
 
Location: Heidelberg, Germany

Join Date: Feb 2010
Posts: 992
Default

If a read maps and its mate does not, htseq-count just uses one mate. If the unmapped mate is not simply marked as unmapped but completely missing from the SAM file, htseq-count does the same, but also complains about this violation of the SAM spec.
Simon Anders is offline   Reply With Quote
Old 05-22-2013, 03:34 AM   #8
canhu
Member
 
Location: beijing,china

Join Date: May 2013
Posts: 11
Default

Quote:
Originally Posted by dpryan View Post
I would need to go through the code for htseq-count to know exactly how it would handle these situations, so you might be best served by either doing that or just contacting Simon Anders, who wrote it. It would be interesting to go through the samtools mailing list to see if this sort of SAM file is the correct behaviour, as the specification is silent on that. I wouldn't rely on the results without being certain that these are being handled correctly (I somewhat naively worry that these sorts of reads could get htseq-count out of sync with the read pairing).

Alternatively, remove any read with the 0x8 bit in the flag set (since the unmapped mates are already missing, this should just exclude the "rescued" reads). I expect that will get rid of the random unpaired reads. You could also simply rerun tophat with the --no-mixed option.
very appreciate for your patient reply. I frist sequence my sample with paired-ends, but the coverage was low , so an additional run with single-end was performed. This is why my data contain single-read and paired-reads. I use tophat to mapping this mixed data and get the bam file. If i use the --no-mixed model or fliter with 'specific' flag value, i think i will lose many meaningful alignment informaton.
__________________
canhu is offline   Reply With Quote
Old 05-22-2013, 04:03 AM   #9
canhu
Member
 
Location: beijing,china

Join Date: May 2013
Posts: 11
Default

Quote:
Originally Posted by Simon Anders View Post
If a read maps and its mate does not, htseq-count just uses one mate. If the unmapped mate is not simply marked as unmapped but completely missing from the SAM file, htseq-count does the same, but also complains about this violation of the SAM spec.
Many thanks for your answer. Sorry for my weird question. Due to the low coverage, I made two RNA-seq runs, one is paired-reads run, the other is single-read run. I use tophat to analysis the mixed data, including paired-reads and single-reads , and get the bam file. From your rely, I am unclear about whether the warning message would influence the count results which will be used for downstream differential expressed gene analysis by DEseq.
Another question about the difference of reads count between paired-end read and single-read. In my 'weird' mixed data, if a read A and its mate are mapped to gene, was the count 1 or 2 ? . if a read B mapped to gene and its mate was missing, was the count 1?
I didn't know how to count the reads in this mixed data.
__________________
canhu is offline   Reply With Quote
Old 05-22-2013, 05:06 AM   #10
Simon Anders
Senior Member
 
Location: Heidelberg, Germany

Join Date: Feb 2010
Posts: 992
Default

A pair in only counted once.

You should process the two libraries separately and then add the counts afterwards.

BTW, what do you mean with "my sample"? Do you have only one?
Simon Anders is offline   Reply With Quote
Old 05-22-2013, 05:40 AM   #11
canhu
Member
 
Location: beijing,china

Join Date: May 2013
Posts: 11
Default

Quote:
Originally Posted by Simon Anders View Post
A pair in only counted once.

You should process the two libraries separately and then add the counts afterwards.

BTW, what do you mean with "my sample"? Do you have only one?
I sequence fish transcriptome, including 10 tissues, 4 conditions, totally 40 samples.I didn't have replicates for each sample, because the cost is too high for me
__________________
canhu is offline   Reply With Quote
Old 05-22-2013, 06:35 AM   #12
Simon Anders
Senior Member
 
Location: Heidelberg, Germany

Join Date: Feb 2010
Posts: 992
Default

Well, had you done your 4 conditions in only, say, 8 tissues, and performed 2 of the tissues in duplicates, you could now do a proper analysis, without having paid any more more money.

Now you will have to resort to guessing, and even though this would be a problem for you, I seriously hope that journals no longer accept submissions with such guesswork (because the guesses usually later turn out to be wrong).

I don't understand why so many people consider such designs as cost effective. (Nobody ever said that you have to perform replicates for all your condition pairs. But not even for a few of them? I simply don't understand this kind of reasoning.)
Simon Anders is offline   Reply With Quote
Old 05-22-2013, 07:25 AM   #13
canhu
Member
 
Location: beijing,china

Join Date: May 2013
Posts: 11
Smile

Quote:
Originally Posted by Simon Anders View Post
Well, had you done your 4 conditions in only, say, 8 tissues, and performed 2 of the tissues in duplicates, you could now do a proper analysis, without having paid any more more money.

Now you will have to resort to guessing, and even though this would be a problem for you, I seriously hope that journals no longer accept submissions with such guesswork (because the guesses usually later turn out to be wrong).

I don't understand why so many people consider such designs as cost effective. (Nobody ever said that you have to perform replicates for all your condition pairs. But not even for a few of them? I simply don't understand this kind of reasoning.)
I am very agree with you point. The biggest question is no replicates. The orignal purpose is to figure out the 'valuable' tissues among total 10 tissues. so each tissue have only one sample. Next I will focus on two or three tissues and get more replicated data. Thanks for all your kindly suggestion. I will try to process seperately and hope can get the results without warning message.
__________________
canhu is offline   Reply With Quote
Old 08-15-2013, 07:05 AM   #14
acervera
Junior Member
 
Location: Helsinki

Join Date: Feb 2012
Posts: 6
Default

Hi,
I am having a similiar problem, i.e. getting lots of warning messages from htseq-count, but I believe my files are properly sorted and I did not mix paired-end with single-end reads.
I used the following commands:
samtools sort -n accepted_hits.bam sorted
samtools view sorted.bam | htseq-count -s no - genes.gtf > counts.txt
Then I get tons of warnings like
Warning: Read SRR316646.sra.ncbi_enc.1030 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
Warning: Read SRR316646.sra.ncbi_enc.1140 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
Warning: Read SRR316646.sra.ncbi_enc.1193 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)

For the first warning the corresponding section of my sorted.bam file looks like this:
SRR316646.sra.ncbi_enc.1029 163 chr6 30036407 50 69M405N7M = 30036975 644 CANAGAAAAAGGTAGAATGGACAAGTGACACTGTGGACAATGAACACATGGGCCGCCGCTCATCCAAATG
CTGCTG [email protected]#@BCCCC;>[email protected][email protected][email protected] XA:i:1 MD:Z:2G73 NM:i:1 XS:A:+ XP:Z:chr6 30036975 76M NH:i:1
SRR316646.sra.ncbi_enc.1029 83 chr6 30036975 50 76M = 30036407 -644 ACGTGGCCACCGCAAAGGACGGCGTCGTGCAACCCTAGGACCGACCCCCACCACACCTCCCCAGCCTCCTGACCCT :[email protected][email protected][email protected]?DECEEABDDD-EEEEC?CBDEDBEEBE;<EEFGDFFFAFAEDFFFFFDE XA:i:1 MD:Z:54C21 NM:i:1 XS:A:+ XP:Z:chr6 30036407 69M405N7M NH:i:1
SRR316646.sra.ncbi_enc.1030 163 chr3 101544467 50 76M = 101544619 196 GTNTTTTACATATAAATATTTTTCTATGTTAAATAGTCTTCATAAGTTAATTATAAAGATCTGCTTAATAGTTCTG @?#<[email protected]=B>[email protected][email protected]? XA:i:1 MD:Z:2T73 NM:i:1 XS:A:+ XP:Z:chr3-chr3 101544619 36M101544702F40m NH:i:1
SRR316646.sra.ncbi_enc.1030 83 chr3 101544619 50 36M = 101544467 -196 TATATCAATTTCAGTGGTTTAAAATATGAATTTCTA [email protected]@BDEEDEDEEFEFEFEFFBFFE?BFDD AS:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:76 NM:i:0 XF:Z:1 chr3-chr3 101544619 36M101544703F40m TATATCAATTTCAGTGGTTTAAAATATGAATTTCTATTCTGGAATATGAGATTCACTACATTAAATTAATACTTTC [email protected]@BDEEDEDEEFE
[email protected]?DDCCD XP:Z:chr3 101544467 76M NH:i:1
SRR316646.sra.ncbi_enc.1030 83 chr3 101544664 50 40M = 101544467 -196 GAAAGTATTAATTTAATGTAGTGAATCTCATATTCCAGAA [email protected]
FFFFFBFFEB AS:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:76 NM:i:0 XF:Z:2 chr3-chr3 101544619 36M101544703F40m TATATCAATTTCAGTGGTTTAAAATATGAATTTCTATTCTGGAATATGAGATTCACTACATTAAATTAATACTTTC [email protected]
[email protected][email protected]?DDCCD XP:Z:chr3 101544467 76M NH:i:1
SRR316646.sra.ncbi_enc.1032 99 chr6 119499446 50 76M = 119499512 142 ATTAGGTGGAACCATATGAAACTGCTGACAGTTTTTAAACTACAAATGCAGCAATTTCATATGTTTCAGCCTAATC EEE:AD:?:CA>[email protected]=CBB:BBA?DBB5B?C=??CAC?=AB?BCAA5?5A XA:i:0 MD:Z:76 NM:i:0 XS:A:- XP:Z:chr6 119499512 76M NH:i:1

Is it ok to ignore the warnings or there is something wrong with my alignment files??
I appreciate any help on these.
Thanks!
acervera is offline   Reply With Quote
Old 08-15-2013, 07:21 AM   #15
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

@acevera: It looks like you have chimeric reads, is this output from tophat-fusion (or tophat2 with --fusion-search)?

Edit: I should add a link to a short back and forth on an identical issue from sourceforge. Counting chimeric reads requires a good bit of forethought. In the case above, both sections probably map to the same gene, which has an inversion. In this case, you only want the read counted once (though it will get counted twice), while in other cases, where the read might map to a fusion of two genes, you might want it counted twice or not at all. I wouldn't expect htseq-count to know exactly how you want each of these cases handled.

BTW, the SAM spec. has only recently been updated to include chimeric alignments, through the addition of the 0x800 flag bit. Tophat doesn't follow that, though given that tophat-fusion predates the specification change, that's pretty unsurprising.

Last edited by dpryan; 08-15-2013 at 07:58 AM.
dpryan is offline   Reply With Quote
Old 08-16-2013, 06:03 AM   #16
acervera
Junior Member
 
Location: Helsinki

Join Date: Feb 2012
Posts: 6
Default

@dpryan: thanks for the reply!
Yes, I used tophat-fusion, so this means that the counts I get from these alignments are unreliable?
Also, I am using dexseq_count.py on my 105 RNA-Seq samples, and only one of the files triggered an error:
ValueError: ("unsupported format character ''' (0x27) at index 34", 'line 433369370
And this is the line:
SRR391511.sra.ncbi_enc.52549224 163 chr3 49396810 50 50M = 49396966 205 GGGAAACCAATTCCTATTTACTTAGCCCAGCTCCATGGGGTACTGAGATA B*CBABA><7ABB6BACAA>;[email protected]@[email protected]@A?=AB<<6-?>BB>A>[email protected] XA:i:1 MD:Z:1T48 [email protected]=?9:@[email protected] XA:i:0 MD:Z:50 NM:i:0 XS:A:- XP:Z:chr3 49397428 50M NH:i:1

Is there something I should fix in that line to make it work? Also, it would be good to know why it is only failing with that one file when all of them have been processed the same way. Thanks for any input in the matter.
acervera is offline   Reply With Quote
Old 08-16-2013, 06:41 AM   #17
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

I wouldn't say that the counts are unreliable, so much as not necessarily representing exactly what you want...though that's just splitting semantic hairs.

In the example you posted above (in #14), if all the parts of that fusion gene mapped to, say, KCNJ12, then that fusion read would end up getting counted twice, which is not what you'll want. If the second part of the fusion read mapped to, say, KCNJ18 (random example), then the whole paired-read would end up getting counted once for each of the genes, which is also probably not ideal.

The conservative solution (short of just realigning) would be to simply remove fusion reads, which could be done with
Code:
samtools view file.bam | grep -v "XF:Z" | htseq-count [options] - GTF_file > counts_file
or something like that. This will still produce a bunch of error messages due to having missing mates, but you remove the chimeric-alignment-double-counting issue. In an ideal world, the counting program would treat chimeric alignments that map to the same feature as a single entity and those aligning to different features in a user-defined manner. If you have some budget to spare, perhaps Simon Anders could be "monetarily encouraged" to modify htseq-count to do that...

Regarding the dexseq_count.py error, it's not clear to me from that line why that would be occuring. It's complaining about there being an apostrophe somewhere, though I don't see one. I suspect there's something with the format of the chimeric read that it doesn't like, but I'm not familiar enough with the inner-workings of the script to say what (perhaps Simon will chime in).
dpryan is offline   Reply With Quote
Old 08-16-2013, 07:34 AM   #18
acervera
Junior Member
 
Location: Helsinki

Join Date: Feb 2012
Posts: 6
Default

Thanks for the quick reply @dpryan
I will try to get the counts again following your suggestion for removing the chimeric/fusion alignments.
It would be great if Simon Anders can implement a better solution for this, but unfortunately "monetary encouragement" is beyond my possibilities at this early stage of my PhD studies ....
So I will give it a try now and perhaps by Monday I will have the new counts.
thanks agan!
acervera is offline   Reply With Quote
Old 10-28-2013, 01:43 PM   #19
adaigle
Junior Member
 
Location: Boston

Join Date: Sep 2013
Posts: 6
Default

Hi, I was wondering if you ever figured out the error message you were describing above? I am getting a similar thing with HTSeq, only it is with the first read of the SAM file.

Error occured when reading first line of sam file.
Error: ("unsupported format character ''' (0x27) at index 34", 'line 30 of file
CAL120_sr.sam')
[Exception type: ValueError, raised in _HTSeq.pyx:1168]

And this is the line:
Y71VY:00004:00106 16 chr10 62135255 0 12M * 0 0 GGGGGGGGAGGG 6666666,,'** ZPBf,0.0155953,0.00769459,0.0049578 ZMBs,266,0,242,0,0,252,0,278,506,0,0,550,262,278,0,0,226,0,260,0,26,38,42,30,104,0,0,0,764,0,0,0,70,0,5224,0,5866,0,0,0,0,0,0,0,120,124,14,122,0,46 ZFi28 RGZY71VY.IonXpress_014 PGZtmap MDZ12 NMi0 ASi12 XAZmap4-1 XSi12

Any help would be GREATLY appreciated!
adaigle is offline   Reply With Quote
Old 10-28-2013, 01:45 PM   #20
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

That appears to be a pretty screwed up SAM line. Did your file get corrupted?
dpryan is offline   Reply With Quote
Reply

Tags
bowtie2, htseq-count, tophat, warning message

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:39 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO