SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
HiSeq X run: i5 index is reverse complement of i7?? bmreilly Illumina/Solexa 3 04-10-2019 04:49 PM
d reverse complement sequences davids Illumina/Solexa 0 06-07-2016 05:57 PM
Remove reverse complement redundancy in stranded transcriptome evt8 RNA Sequencing 4 11-05-2014 03:28 PM
gtf file reverse complement coordinates lwhitmore Bioinformatics 4 08-20-2014 08:03 AM
Reverse complement of a bacterial gene seema12345 Introductions 4 03-07-2014 07:00 PM

Reply
 
Thread Tools
Old 06-13-2019, 05:02 AM   #1
dineshkumarsrk
Junior Member
 
Location: India

Join Date: Mar 2019
Posts: 5
Default How to reverse complement the nuclotides, if the coordinates are in reverse order?

I have the series of coordinates in id.txt file, whose coordinates sequences are in genome.fasta file. The coordinates of id.txt file is shown below,
Contig3:15-7
Contig2:5-10
Contig1:12-3

The genome.fasta file is shown below,
>Contig1
AAGGCCATCAAGGACGTGGATGAGGTCGTCAAG
>Contig2
ACGAAGCGCTCGCCAAGGCCGAAGAAGAAGGCC
>Contig3
GCTGCGGCGCTGATCCTGGCGGCCCGCGCCGAG

I have used the following codes to extract the sequences from genome.fasta based on the coordinates in <id.txt> by using the following command <xargs samtools faidx genome.fasta <id.txt > result.fasta> It has extracted only <Contig2:5-10sequence>. Because, the coordinates of <Contig2:5-10> is in proper order. But <Contig3:15-7> and <Contig1:12-3> coordinates are in reverse order, So samtools could not fetch those sequences.

I need to extract those sequences from <Contig2:5-10> and <Contig3:15-7> coordinates and also I want to reverse complement them. I have larger fasta file and plenty of coordinates sequences to be extracted, So I need to automate this process. So, please help me to automate this process. Thank you in advance.
dineshkumarsrk is offline   Reply With Quote
Reply

Tags
bioinformatics, python, shell-script, unix

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:33 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO