SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Consensus fastq to VCF jaavedm Bioinformatics 0 09-06-2013 06:43 AM
VCFtools vcf-consensus error jeffseq Bioinformatics 1 09-01-2013 08:14 PM
New consensus from VCF dbrami Bioinformatics 9 09-20-2012 11:35 PM
Consensus from a VCF file szilva Bioinformatics 1 09-20-2012 10:01 PM
Extract Infor from 1000G VCF files liu_xt005 Bioinformatics 1 11-21-2011 02:33 PM

Reply
 
Thread Tools
Old 11-06-2013, 12:32 AM   #1
sophix
Junior Member
 
Location: Europe

Join Date: Oct 2013
Posts: 3
Default vcf-consensus for individuals from 1000G

Hi,

I would like to create consensus sequence for an individual from 1000G where the sequence incorporates variants typed for this individual.

Using tabix and vcf-tools (vcf-subset), I extracted the relevant variant information from 1000G SNP call files.

At this point, I have variants per chromosome for individual HG000096.

I would like to incorporate these variants into reference coding sequence.

I downloaded all protein-coding sequences for the GRCh37 version from Ensembl Biomart.

An example with trimmed sequence looks like this:

Code:
>ENSG00000003137|ENST00000001146|ENSP00000001146|2|72356367|72375167
ATGCTCTTTGAGGGCTTGGATCTGGTGTCGGCGCTGGCCACCCTCGCCGCGTGCCTGGTG
TCCGTGACGCTGCTGCTGGCCGTGTCGCAGCAGCTGTGGCAGCTGCGCTGGGCCGCCACT
CGCGACAAGAGCTGCAAGCTGCCCATCCCCAAGGGATCCATGGGCTTCCCGCTCATCGGA
Note: typical fasta sequence file with the header including gene|transcript|protein|chr|chr_start|chr_end

My understanding is that there are a few alternatives out there to produce consensus sequences given a reference fasta sequence and variant call file: (1) AlternativeReferenceMaker, (2) vcf-consensus, (3) mpileup.

I would like to use vcf-consensus for my task.

vcftools describes the use of vcf-consensus as follows:

Code:
cat ref.fa | vcf-consensus file.vcf.gz > out.fa
I presume that the reference file here refers to the reference DNA sequence including coding and non-coding parts of the genome. In that case, my protein-coding sequence above would not work as an acceptable reference sequence. Nevertheless, I am only interested in the protein-coding part.

How can I modify vcf-consensus or my input sequences to create consensus coding sequence for HG00096 given the reference coding sequence and his variants?

Thank you very much.

As soon as I figure out a way to get this done, I will have a follow-up question concerning the diploidy, that is, how can I tell whether a variant is called at a heterozygous site or not.
sophix is offline   Reply With Quote
Old 11-06-2013, 04:30 AM   #2
lindenb
Senior Member
 
Location: France

Join Date: Apr 2010
Posts: 143
Default

cross posted on biostars: http://www.biostars.org/p/85681/
lindenb is offline   Reply With Quote
Old 11-06-2013, 04:43 AM   #3
sophix
Junior Member
 
Location: Europe

Join Date: Oct 2013
Posts: 3
Default

Quote:
cross posted on biostars: http://www.biostars.org/p/85681/
Yes! Thank you for the link.
sophix is offline   Reply With Quote
Old 02-23-2017, 01:36 AM   #4
rajeshkmaurya08
Member
 
Location: india

Join Date: Feb 2017
Posts: 14
Default

Can anybody help to figure out this problem?
rajeshkmaurya08 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:02 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO